select record from datatable c using linq
MICROPROCESSORS FROM ASSEMBLY LANGUAGE TO C USING THE PIC18FXX2 docx
... ^ CiABCiSCoFull AdderFACiCoA[3:0]B[3:0]CiS[3:0]Co+CiCo4-bit AdderTruth Table forFull AdderCi - Carry InS - SumCo - Carry OutA0B0CiS0CoExpanded 4-bit AdderFACiCoA1B1CiS1CoFAA2B2CiS2CoFAA3B3CiS3CoFAFIGURE ... useful combina-tional building blocks such as a subtractor, decrementer, adder/subtractor, and26MicroprocessorsCLKDCKRQ10RESETDNNNQLDCNTINCQLDRCKNNINCYAN NINCDincrementerFIGURE ... and C, while hardware interfacing examples uses C to keep code complexity low and improve clarity. The book’s CD-ROM includes a120-day demo version of the PICC-18 C compiler for the PIC18F242 from...
- 687
- 1,206
- 0
Text extraction from name cards using neural network
... ==ì=cavg c ccavg c cncnlavg_0_0_; (2) ==ì=255_255__cavgc c cavgc c ncnravg; (3) ]255,0[),(_ = cnstdstdn c ; (4) ]_,0[),(_ cavgcnstdstdl c =; (5) ]255,_[),(_ cavgcnstdstdr c ∈=. ... Take cavgF _= as an example, then: )_,_max()_,_min())(),(max())(),(min(),,(2121212121cccccavgcavgcavgcavgCFCFCFCFFCCSIM== (7) then the relative similarity RSIM for a certain ... found in name card scanners which readily capture name card images followed by optical character recognition (OCR) to build a name card database. The application provides for document information...
- 6
- 563
- 3
Using LINQ to DataSet
... disparate sources. You can mix LINQ to Objects and LINQ to DataSet content in the same query simply by including each source in the From clause. C# // Build an ad hoc collection, although you could ... a LINQ query.Dwonloaded from: iDATA.ws Chapter 18 Using LINQ to DataSet 313Chapter 18 Quick ReferenceTo Do ThisInclude a DataTable instance in a LINQ query Call the DataTable object’s ... CurrentStatus = sts.Description Order By OrderIDAs in LINQ to Objects, the actual processing of a LINQ to DataSet query does not occur until your code references content from a constructed query. However,...
- 10
- 561
- 0
Using LINQ to Entities
... "A" select cu;Visual BasicDim result = From cu In context.Customers Where EntityFunctions.Left(cu.FullName, 1) = "A" Select cuBeyond the canonical functions, LINQ to Entities ... CustomerName = cu.FullName };}Visual Basic Using context As New SalesOrderEntities(connectionString) Dim results = From cu In context.Customers Order By cu.FullName Select CustomerID = cu.ID, CustomerName ... string-conversion functions from SQL Server can be called from LINQ: Ascii, Char, CharIndex, Difference (a Soundex-related function), IsDate, IsNumeric, NChar, PatIndex, QuoteName, Replicate, SoundCode (more...
- 16
- 840
- 0
Using LINQ to SQL
... Chapter 20 Using LINQ to SQL 335 C# using (SalesOrderLink context = new SalesOrderLink(connectionString)){ var results = from cu in context.Customers orderby cu.FullName select new { CustomerID ... CustomerID = cu.ID, CustomerName = cu.FullName };}Visual Basic Using context As New SalesOrderLink(connectionString) Dim results = From cu In context.Customers Order By cu.FullName Select CustomerID ... context.Customers Select cu.ID, cu.FullName, context.AgedInvoices(cu.ID, 90) Order By cu.FullNameYou can also call these functions directly, as long as a valid context exists. C# decimal pending = context.AgedInvoices(whichCustomer,...
- 13
- 594
- 0
Combating NOx from refinery sources using SCR by Hans Jensen-Holm and Peter Lindenhoff pot
... Catalytic Cracking (FCC) units in which FCC catalyst fines are carried over from the regenerator. L: Wave length t: Wall thickness P c : Channel pitch Pp: Plate pitch L t P c Pp ... deactivation mechanism 11 4.2 SCR DeNOx in fluid catalytic cracking units (FCCU) 14 4.2.1 SCR design issues 14 4.2.2 ABS condensation considerations 15 4.2.3 Catalyst selection 17 4.2.4 Catalyst cleaning ... The SCR DeNOx process and catalyst 5 3.1 The SCR process 5 3.2 The SCR catalyst 7 4 Refinery SCR applications 10 4.1 SCR for steam cracking and reformer furnaces 10 4.1.1 Chromium deactivation...
- 31
- 363
- 0
Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel fluorescent probe pdf
... 12-myristate 13-acetatewere obtained successfully using a confocal laser scanning microscope.AbbreviationsDBZTC, 2-chloro-1,3-dibenzothiazolinecyclohexene; ROS, reactive oxygen species; SOD, superoxide ... salt effect thatdecreases fluorescence intensity.Effect of the fluorescent probe concentrationThe concentration of DBZTC directly decided whetherO2ặ was trapped completely, which determined ... molecules, but can also be convertedto other more toxic radicals such as HOặ,H2O2,1O2,and so on [3]. Under consenescence or special physicalconditions, excessive O2ặ can lead to coronary...
- 9
- 401
- 0
Báo cáo khoa học: Investigation of the substrate specificity of a b-glycosidase from Spodoptera frugiperda using site-directed mutagenesis and bioenergetics analysis pdf
... (underlined) and mutated codon (NNN,in bold). Thus, the primer sequence used on mutations atposition 3 9 was 5 Â-CGCTACAGCCTCCTACNNNATCGAAGGTGCTTGG-3Â, w ith AAC and GAG as themutated codons for Q39N ... (1998) The family 1 b-glucosidases from Pyrococcus furiosus and Agrobacterium f aecalis shar e acommon catalytic mechanism. Biochemistry 37 , 17170–17178.5. Paloma, F., Can˜ada, F.J., Barbero-Jime´nez, ... substrate isaccommodated by the aglycone subsite2, which may actuallybe composed of several subsites (+1, +2, +3, etc.).According to the CAZy database, family 1 currentlycomprises 427 b-glycosidases,...
- 9
- 371
- 0
released from the grip of what he carried freedom from his c
... member of the infantry, carries not only hatchet with which hecuts off a thumb of an enemy. Harry Dobbins carried his girlfriend'spanties around his neck, and Dave Jansen carried ear plugs.Throughoutthe ... soldiers carry on tour. O'Brien tells how much certainitems weigh and what they are used for It is as if Cross can't help but tothink of this woman when he gets bored of the war. Cross ... Howshe herself had no special feelings for Cross and she was just writing tohim because she felt a responsibility to. Although seemingly reaching outto him, she in fact had no deep feeling for...
- 2
- 245
- 0
PREDICTION OF CHEMICAL REACTIVITY PARAMETERS AND PHYSICAL PROPERTIES OF ORGANIC COMPOUNDS FROM MOLECULAR STRUCTURE USING SPARC pptx
... Fraction Figure 4. Fraction of the major microscopic species of N-phenylglycine as a function of pH The numbers on the top of each curve correspond to the microscopic species. 1, 3, 2N, 2Z corresponds ... R, and ρele describes the susceptibility of a particular reaction center to electrostatic effects. Since the reaction center can not discriminate the sources of the electric fields, ρele ... “mechanistic” descriptions commonly utilized in structure-activity analysis, such as induction, resonance and field effects. SPARC execution involves the classification of molecular structure...
- 158
- 631
- 0
Báo cáo khoa học: Llama single-domain antibodies directed against nonconventional epitopes of tumor-associated carcinoembryonic antigen absent from nonspecific cross-reacting antigen doc
... VH1S:5Â-CATGCCATGACTCGCGGCCCAGCCGGCCATGGCCCAGGTGCAGCTGGTGCAGTCTGG-3Â;5Â VH2S:5Â-CATGCCATGACTCGCGGCCCA GCCGGCCATGGCCCAGGTCACCTTGAAGGAGTCTGG-3Â;5Â VH3S:5Â-CATGCCATGACTCGCGGCCCA GCCGGCCATGGCCGAGGTGCAGCTGGTGGAGTCTGG-3Â;5Â ... pJFVH3S (CTTTACTATTCTCACGGCCATGGCGGCCGAGGTGCAGCTGGTGG) and 3Â c- myc–6His ⁄ HindIII (CCGCGCGCGC CAAGACCCAAGCTTGGGCTARTGRTGRTGRTGRTGRTGTGCGGCCCCATTCAGATC) to add the HindIII site for further cloning, ... GCCGGCCATGGCCGAGGTGCAGCTGGTGGAGTCTGG-3Â;5Â VH4S:5Â-CATGCCATGACTCGCGGCCCA GCCGGCCATGGCCCAGGTGCAGCTGCAGGAGTCGGG-3Â) and one for-ward primer (CH2FORTA4). These primers allow the ampli-fication of two bands corresponding...
- 13
- 529
- 0
Báo cáo khoa học: "Identifying Word Translations from Comparable Corpora Using Latent Topic Models" potx
... LinguisticsIdentifying Word Translations from Comparable Corpora Using LatentTopic ModelsIvan Vuli´ c, Wim De Smet and Marie-Francine MoensDepartment of Computer ScienceK.U. LeuvenCelestijnenlaan ... approach borrows an idea from informationretrieval and constructs word vectors over a sharedlatent topic space. Values within vectors are theTF-ITF (term frequency - inverse topic frequency)scores ... importance of the source word wiacross allsource topics. Rare words are given a higher im-portance and thus they tend to be more descriptivefor a speci c topic. The inverse topical frequencyfor...
- 6
- 449
- 0
Báo cáo khoa học: "Learning to Extract Relations from the Web using Minimal Supervision" ppt
... the Association of Computational Linguistics, pages 576–583,Prague, Czech Republic, June 2007. c 2007 Association for Computational LinguisticsLearning to Extract Relations from the Web using ... generic placeholders for the twoentity names. The subsequence kernel induces afeature space where each dimension correspondsto a sequence of words. Any such sequence thatmatches a subsequence ... the corpo-rate acquisition relationship. For each pair, a bag ofsentences containing the two arguments can be ex-tracted from a corpus of text documents. The corpusis assumed to be sufficiently...
- 8
- 371
- 0
removal of basic blue 159 from aqueous solution using
... phenolic compounds. Different processes for color removal typically include physical, chemical and biological schemes. Some processes, such as electrochemical techniques and ion pair extraction, ... the adsorption capacity of some speci c solutes through ionic interactions. Natural sorbents have been obtained from agricultural waste, such as corn cobs, coconut shell, sugar cane bagasse ... the peaks around 3444.64 cm-1, 2923.34 cm-1, 1733.88 cm-1 and 1037.36 cm-1 resulted from O-H stretch, C- H stretch, C= O stretch and C- O stretch, respectively. It can be found that banana...
- 12
- 528
- 0
Using LINQ to SQL_1 potx
- 21
- 381
- 1
Using LINQ to SQL_2 pot
- 21
- 381
- 1
Using LINQ to SQL_3 pot
- 21
- 485
- 1
Using LINQ to SQL_4 potx
- 19
- 485
- 1
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008