secondary prevention of hepatitis c

báo cáo khoa học: " The effectiveness of behavioural interventions in the primary prevention of Hepatitis C amongst injecting drug users: a randomised controlled trial and lessons learned" pot

Ngày tải lên : 11/08/2014, 18:20

12
454
0

Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"

Ngày tải lên : 02/11/2012, 09:56

... Hepatitis C virus all need to be elucidated. Conflict of interest The authors have declared that no conflict of interest exists. References 1. WHO. Global surveillance and control of hepatitis C. ... world. Incidence rates across the world fluctuate and are difficult to calculate given the asymptomatic, often latent nature of the disease prior to clinical presentation. Prevalence rates across ... HCV transmission to others. The physician should also offer counseling on treatment, reducing alcohol usage and immunization with hepatitis A, hepatitis B, pneumococcal and influenza vaccines....

6
486
0

Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"

Ngày tải lên : 02/11/2012, 09:56

... cirrhosis, hepatocellular carcinoma, HCV, HCC 1. Introduction Chronic hepatitis C is the most common cause of chronic liver disease and cirrhosis, and the most common indication for liver transplantation ... immunodeficient patients. The anti-HCV assay detects greater than 90% of HCV infections after the initial 3 months. 4. Chronic Hepatitis C Chronic hepatitis C is marked by the persistence of HCV ... development of complications, among different racial and ethnic groups with HCV infection. For unclear reasons, African Americans appear to have a higher rate of chronic HCV infection than Caucasians...

6
530
0

Báo cáo y học: "Molecular Virology of Hepatitis C Virus (HCV): 2006 Update"

Ngày tải lên : 02/11/2012, 10:00

... Comparison of different replicon systems. A selection of different bicistronic and monocistronic replicon constructs including subgenomic and full-length HCV sequences is depicted schematically. ... Rice CM. Efficient initiation of HCV RNA replication in cell culture. Science 2000; 290: 1972-4. 10. Bartosch B, Dubuisson J and Cosset FL. Infectious hepatitis C virus pseudo-particles containing ... research focus includes molecular biology and immunology of viral hepatitis B and C as well as basic and clinical aspects of gastrointestinal malignancies, especially hepatocellular and colorectal...

6
497
1

Báo cáo y học: "Epidemiology and Prevention of Hepatitis B Virus Infection"

Ngày tải lên : 02/11/2012, 11:12

... adolescent vaccinatin programmes in Italy. Vaccine 2000;18:S31-S34. 77. Chang MH, Chen CJ,cLai MS. Universal hepatitis B vaccination in Taiwan and the incidence of hepatocellular carcinoma in children. ... genotype C in China [34]. Accumulated data suggest the importance of genotype, subgroup and recombination that may influence the biological characteristics of virus and clinical outcome of HBV infection. ... efficacy of newborn vaccination was 85.42%. In countries such as Italy and the United States, the incidence of acute hepatitis B has declined dramatically during the past decade after vaccination...

8
643
0

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Ngày tải lên : 20/02/2014, 01:20

... Pasteur, Paris, France). The primers used were VB1: 5¢-AAACATATGA GCATGAGCTACCACCTGGACC-3¢ and VB3: 5¢-CTCG AGCTTCACAAGAAACTTCTGC-3¢. The PCR fragment was cleaved by the restriction enzymes Nde1 ... molecular clone pCV-J4L6S [21] kindly provided by J. Bukh (NIH, Beth- esda, MD, USA). The primers used were NS5Bj4s2: 5¢-GATATCATGTCAATGTCCTATACGTGGAC-3¢ and NS5Bj4r 5¢-AAACTCGAGGCGGGGTCGGGCACGAGA CAGG-3¢. ... relevance of sequences and ⁄ or structures implicated in this step of viral RNA replication in the infected cells. Experimental procedures Recombinant HCV RdRp The recombinant HCV NS5B-D21 of H77...

15
597
0

Báo cáo khoa học: Halogenated benzimidazoles and benzotriazoles as inhibitors of the NTPase/helicase activities of hepatitis C and related viruses ppt

Ngày tải lên : 08/03/2014, 02:20

... protein truncated 159 aa from the amino terminus, was ampliﬁed by PCR using the following primers: forward, 5¢-CATGCC ATGGCGCCATTTTTCTTGAGACATGCC-3¢; reverse, 5¢-CTGGGATCCGTCCGAATCAGGTTCCTTC-3¢ (purchased ... benzimidazoles/benzotriazoles. Hepatitis C virus (HCV) infection, which results in chronic or acute hepatitis, and may lead to liver cirrhosis and hepatocellular carcinoma, is currently known to affect more than 3% of the population ... under conditions described above. Effect of preincubation of compounds with enzyme on unwinding and hydrolysis efﬁcacy The selected enzyme was preincubated with a given compound at 30 °Cin20lL of...

9
659
0

Diagnosis, Management, and Treatment of Hepatitis C: An Update docx

Ngày tải lên : 08/03/2014, 14:20

... adjunct to treatment of HCV infection (Class IIa, Level C) . Treatment of Persons with Psychiatric Illnesses Patients with chronic HCV infection have a higher prevalence of psychiatric illness compared ... the presence of HCV infection (Table 2) (Class I, level B). Counseling. Good clinical practice dictates that persons found to be HCV-infected are counseled regarding prevention of spread of the ... from child to child is rare. Therefore, the American Academy of Pediatrics does not recommend restricting children with chronic HCV infection from school attendance or participation in routine activities, including...

40
998
0

Management of hepatitis C pot

Ngày tải lên : 08/03/2014, 14:20

... family, or close contacts, and sexual partners. Cohort studies of couples discordant for HCV indicated an HCV incidence of 0-2 per 1,000 years of sexual contact.  Those with HIV co-infection, ... 5 Children and hepatitis C 10 6 Acute hepatitis C 12 7 Assessment of liver disease 13 8 Progression of untreated disease 15 9 Treatment of chronic hepatitis C 18 10 Treatment of advanced infection ... Medical Association Scottish General Practice Committee Professor Hilary Capell Royal College of Physicians and Surgeons of Glasgow Ms Anne Marie Hawthorne Royal College of Nursing Professor...

55
323
0

Báo cáo khoa học: Recent contributions of in vitro models to our understanding of hepatitis C virus life cycle pdf

Ngày tải lên : 16/03/2014, 05:20

... of primary cell culture HCV-LP Infection, morphogenesis cell attachment vaccination morphogenesis no secretion of particles independence of CD81 for entry HCVpp Infection entry process no budding ... ER exogenous core no association of particles with lipoproteins HCVcc Entire life cycle entry process replication mechanisms intracellular host defence evasion mechanisms virus production antiviral screening restricted ... are chronically infected worldwide [1]. HCV infection causes major health problems because it is a principle cause of chronic liver diseases, including cirrhosis and hepatocellular carcinoma....

14
532
0

Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc

Ngày tải lên : 18/06/2014, 18:20

... indicated by a dot. A 63  TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGA TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG ... GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT ... CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGATCGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT  283 B Background1 TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCG...

12
354
0

$Báo cáo hóa học: " Separation of Hepatitis C genotype 4a into IgG-depleted and IgG-enriched fractions reveals a unique quasispecies profile" docx$

Báo cáo hóa học: " Separation of Hepatitis C genotype 4a into IgG-depleted and IgG-enriched fractions reveals a unique quasispecies profile" docx

Ngày tải lên : 20/06/2014, 01:20

... Pure LC (Roche Diagnostics Ltd. UK,) according to the MagNA Pure LC Total Nucleic Acid Isolation Kit protocol (Catalogue No: 03038505001, Roche Diagnostics Ltd., UK) from 25 μl of an unfractionated ... Abstract Background: Hepatitis C virus (HCV) circulates in an infected individual as a heterogeneous mixture of closely related viruses called quasispecies. The E1/E2 region of the HCV genome ... Neither of these latter events, which are rare occurrences in genotype 4a, was identified in the IgG-enriched fraction. Conclusion: In conclusion, the homogeneity of the IgG-enriched species is...

9
288
0

Báo cáo y học: "Sustained eradication of hepatitis C virus by low-dose long-term interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report" pptx

Ngày tải lên : 10/08/2014, 23:21

... et al . Journal of Medical Case Reports 2011, 5:246 http://www.jmedicalcasereports.com/content/5/1/246 Page 3 of 4 CAS E REP O R T Open Access Sustained eradication of hepatitis C virus by low-dose ... transplant recipients [2]. Besides accelerated deterioration of liver function in chronic HCV infection, HCV-related glomerulopathy [3] and HCV-associated fibrosing cholestatic hepatitis [4] ... the end of the article Chang et al . Journal of Medical Case Reports 2011, 5:246 http://www.jmedicalcasereports.com/content/5/1/246 JOURNAL OF MEDICAL CASE REPORTS © 2011 Chang et al; licensee...

4
282
0

$Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt$

Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt

Ngày tải lên : 11/08/2014, 07:21

... sequence (5'accgtggagtgggggggcaggaggggctcagggagaaagtgcatacagccc ctggccctctctgcccttccgtcccctgt ttttc-3') (Promega). The Rluc:miR-328 binding site reporter constructs, in which Rluc is coupled ... HCV IRES nt 1-515 segment was amplified by PCR from pHCV7 7c using forward (5'-gcgcgcggatccgccagccccct- gatgggggcgacac-3') and reverse (5'-gcgcgcggatccaggttgcgac- cgctcggaagtcttcc-3') ... (5'- gagagagaattccggtcgggacgctctggcc-3') and reverse (5'gcgcgcaagcttcttaat- gctttcgctttcc-3') oligonucleotides, and cloned in the EcoRI/HindIII sites of pBluescript II KS(+) vector (Invitrogen),...

13
362
0

Báo cáo khoa hoc:" Recurrence of hepatitis C virus during leucocytopenia and spontaneous clearance after recovery from cytopenia: a case report" pot

Ngày tải lên : 11/08/2014, 10:22

... Santantonio T, Cucchiarini M, Cerny A, Pape GR: Association of hepatitis C virus-specific CD8+ T cells with viral clearance in acute hepatitis C. J Infect Dis 2000, 181:1528-1536. 3. Pham TN, MacParland ... BioMed Central Page 1 of 3 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case report Recurrence of hepatitis C virus during leucocytopenia and spontaneous clearance ... loss of virus-specific CD4(+) T-cell response in acute hepatitis C. Gastroenterology 1999, 117:933-941. 2. Gruener NH, Gerlach JT, Jung MC, Diepolder HM, Schirren CA, Schraut WW, Hoffmann R, Zachoval...