protocols is included as a function of the internet
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt
Ngày tải lên :
08/03/2014, 10:20
... LPSs is due to an increase in the rate
of the initial fast phase, i.e. oxidation of the a chains. The
rates of oxidation are reduced in the presence of chelators of
heavy metal cations in most cases. ... oxidation mediated by the smooth LPS
was less affected by the presence of EDTA. The rough
S. minnesota LPS increased the initial fast phase of the
reaction, but decreased the rate of the slow phase ... in
concentration of oxyHb with time was utilized as a measure
of the rate of oxidation of oxyHb.
RESULTS
The effect of pH on the auto-oxidation of cross-linked Hb
was studied. The rate of decrease of the...
- 6
- 748
- 0
Báo cáo sinh học: " The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx
Ngày tải lên :
18/06/2014, 22:20
... the premature release of unassembled viral
RNA. It may also enhance virus packaging as it appears
that the assembly of coronavirus occurs intracellularly,
probably in the intermediate compartments ... human coronaviruses,
Table 1: Amino acid sequences of the cytoplasmic tail of spike (S) proteins of coronaviruses are compared with the YxxΦ (where x is
any amino acid and Φ is an amino acid ... between the
endoplasmic reticulum and Golgi apparatus [24]. Clearly,
this has certain advantages for the virus at certain stages of
its life cycle. In addition, a reduction in the cell surface
expression...
- 5
- 310
- 0
báo cáo hóa học:" The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx
Ngày tải lên :
20/06/2014, 04:20
... (diacidic) motif was found to be essential
for the transport of 3a to the cell surface, consistent with
the role of these motifs in the transportation of other pro-
teins to the plasma membrane ... Health Organization, http://www.who.int/csr/
sars/country/en/). A novel coronavirus was identified as
the aetiological agent of SARS [1]. Analysis of the nucle-
otide sequence of this novel SARS ... [13,15].
Presentation of the hypothesis
The cellular fate of the S protein has been well mapped
[16,17]: S is cotranslationally glycosylated and oligomer-
ized at the endoplasmic reticulum. Its N-linked high man-
nose...
- 5
- 365
- 0
Báo cáo vật lý: "The Hidden Property of Arrhenius-type Relationship: Viscosity as a Function of Temperature" doc
Ngày tải lên :
07/08/2014, 14:20
... ini, satu persamaan untuk menggantikan hubungan jenis
Arrhenius telah diterbitkan. Ini adalah kerana pemalar tenaga keaktifan daripada
persamaan itu bukan dalam bentuk asas. Persamaan baru ini ... mengekalkan sifat asal
tenaga keaktifan dan kelikatan pada suhu tidak terhingga, dan ia merangkumi pemalar
baru, iaitu kelikatan pada suhu sifar. Nisbah kelikatan pada suhu sifar dan kelikatan ...
pada suhu tidak terhingga merupakan nilai asas untuk pemalar tenaga keaktifan. Model
ini telah diuji dengan enam minyak sayur-sayuran dan kejituannya terbukti (R kuasa dua,
0.999). Kestabilan...
- 10
- 496
- 1
Reading Theory as a Microcosm of the Four Skills
Ngày tải lên :
06/09/2013, 10:10
... giving the L2 student both as much input and practice as they can
reasonably manage, and a strong metalinguistic awareness, we, as teachers give the student
the tools to learn a language proficiently. ... One of the most important initial tasks for any teacher is the task of knowing his clients.
The notion of needs analysis is absolutely central. Even with as few details as we have
outlined above, ... only taught as a means to accessing literature, be it
classical, technical or otherwise. Any of the group that actually work, will almost certainly
be trying to improve their English, as a means...
- 5
- 680
- 0
Characterization of Spin Coated Polymers in Nano-environments as a Function of Film Thickness pot
Ngày tải lên :
23/03/2014, 01:20
... 12
2.6 Thermal Mechanical Analysis
2.6.1 Theory
Thermal mechanical analysis can be used to assess the glass transition of a thin
film system. The sample is placed in a temperature-controlled chamber ... properties of diverse samples.
The linearly polarized light is reflected off the sample surface. Data are taken across an
area of the surface and averaged to give a more accurate representation of the ... used. Although the
value of permittivity began at a reasonable value, it increased as the temperature
increased. This increase could have been caused by a build up of charge between the
plates.
0
5
10
15
20
Permittivity
20...
- 80
- 375
- 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
Ngày tải lên :
23/03/2014, 05:22
... Idem
MAP2-for
MAP2-rev
GCTTGAAGGCGCTGGATCTGCGACAATAG
GACTGGGCTTTCATCAGCGACAGGTGGC
91489–91517
92431–92404
NC_000067 Idem
Tau-for
Tau-rev
GTGAACCACCAAAATCGGAGAACGAAGC
CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC
78772–78800
79013–78981
NC_000077 Idem
STOP-for
STOP-rev
AGAGTCGGATGCAGTTGCCCGGGCAACA
GGCTCCTCCAGCACCCTCCGGGTCCCG
210–237
657–631
NC_000073 ... [11,12,45].
Investigations on the biochemical basis of lissencephaly,
a human neurological disease characterized by an
abnormal layering of brain cortex, led to the discovery
of these two proteins, which are lacking ... Idem
Doublecortin-for
Doublecortin-rev
CCCCAAACTTGTGACCATCATTC
GGAGAAATCATCTTGAGCATAGCG
705–728
967–943
NM_010025 Idem
LIS1-for
LIS1-rev
CGAACTCTCAAGGGC
ATGCATCAGAACCATGCACG
1288–1303
1427–1407
NM_95116 Idem
Tubulin a6 -for
Tubulin a6 -rev
AGCCCTACAATTCCATCCTCACC
GCTGAAGGAGACGATGAGGGTGA
6854–6876
7646–7624
NC_000081...
- 14
- 416
- 0
báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx
Ngày tải lên :
18/06/2014, 22:20
... indicate whether they had
a disease or another health condition diagnosed by a
health professional that had lasted, or was expected to
last, 6 months or more. These data were used to classify
the ... the
authority of the Statistics Act. Access to the data was
granted by Statistics Canada based on a peer-reviewed
proposal for this study. The researchers did not have
access to any identifying information ... of other studies. For example,
adequate physical activity was associated with a signifi-
cant reduction in the number of days of poor physical and
mental health status in adults with arthritis...
- 11
- 619
- 0
Báo cáo y học: "Cornual pregnancy as a complicaton of the use of a levonorgestrel intrauterine device: a case report" pdf
Ngày tải lên :
11/08/2014, 14:20
... Cases Database
Any patient, any case, can teach us
something
www.casesnetwork.com
general practitioner the same day. She had no history of
prior ectopic pregnancy, pelvic inflammatory diseases ... consent was obtained from the patient
for publication of this case report and any accompanying
images. A copy of the written consent is available for
review by the Editor-in-Chief of this journal.
Competing ... whereas an
interstitial pregnancy implants within the myometrium
of the proximal and intramural portion of the fallopian
tube [5].
Most of the risk factors of ectopic pregnancies are known.
The...
- 4
- 341
- 0
Báo cáo khoa học: " Air embolism as a cause of the systemic inflammatory response syndrome: a case report" pps
Ngày tải lên :
12/08/2014, 19:22
... were heard. The patient was orally intubated and
placed on mechanical ventilation. A diagnosis of venous air
embolism was made and the patient was taken to a hyper-
baric chamber for treatment ... (elevated cardiac output, decreased systemic
vascular resistance, tachypnea, fever and diffuse intravascular
coagulation) was compatible with the diagnosis of SIRS.
The rapidity of the patient’s ... aggregation and the release of plasminogen-
activator inhibitor [13]. This mechanism has been implicated
as a trigger to the cascade of cytokines thought to be
causative agents of SIRS, among them...
- 3
- 219
- 0
Báo cáo khoa học: "Regional distribution of acoustic-based lung vibration as a function of mechanical ventilation mode" docx
Ngày tải lên :
13/08/2014, 03:20
... (Figure
6b).
Regional area analysis demonstrated that the increase in the
total area was due to the expansion of the lower lung region
whereas areas in the upper and the middle regions decreased
(Table 3). Assessment ... to assess the regional
distribution of vibration in the lungs: image analysis and raw
numerical data calculation. In contrast to image analysis, the
numerical method was not affected by normalization. ... predefined rules and criteria listed below. The MEF area of
the VRI image was measured using the software ImageJ
(National Institute of Health, Bethesda, MD, USA) [15].
Regional areas were obtained by...
- 13
- 310
- 0
Báo cáo khoa học: "Cystatin C: unsuited to use as a marker of kidney function in the intensive care unit" pot
Ngày tải lên :
12/08/2014, 22:21
... this issue are
warranted.
Competing interests
The author(s) declare that they have no competing interests.
References
1. Villa P, Jiménez M, Soriano MC, Manzanares J, Casasnovas P:
Serum cystatin ... M,
Piera C, Darnell A: Serum cystatin C as a new marker for non-
invasive estimation of glomerular filtartion rate and as a
marker for early renal impairment. Am J Kidney Dis 2000, 36:
29-34.
... C as a marker of acute renal dysfunction in
critically ill patients. Crit Care 2005, 9:R139-R143.
2. O’Riordan SE, Webb MC, Stowe HJ, Simpson DE, Kandarpa M,
Coakly AJ, Newman DJ, Saunders JA,...
- 2
- 297
- 0