preparation of metal loaded porous carbons and their use as a highly active catalyst for reduction of nitric oxide no
CARBON NANOTUBES 2012 pptx
... field of carbon nanotubes is marked by the publication by Iijima of the observation of multi-walled nanotubes with outer diameters as small as 55 A, and inner diameters as small as 23 A, and a nanotube ... microscopy of carbon nanotubes and nanocones 65 T W EBBESEN and T TAKADA: Topological and SP3 defect structures in nanotubes 71 S IHARA and S ITOH: Helically coiled and torodial cage forms of graphitic ... 1 0a results in a cylinder that has a diameter (ca nm) and a 22-carbon atom repeat cycle and a single hexagon screw pitch -the smallest archetypal (isolated pentagon) example of a graphene nanotube...
- 202
- 591
- 0
CARBON NANOTUBES ppt
... field of carbon nanotubes is marked by the publication by Iijima of the observation of multi-walled nanotubes with outer diameters as small as 55 A, and inner diameters as small as 23 A, and a nanotube ... microscopy of carbon nanotubes and nanocones 65 T W EBBESEN and T TAKADA: Topological and SP3 defect structures in nanotubes 71 S IHARA and S ITOH: Helically coiled and torodial cage forms of graphitic ... 1 0a results in a cylinder that has a diameter (ca nm) and a 22-carbon atom repeat cycle and a single hexagon screw pitch -the smallest archetypal (isolated pentagon) example of a graphene nanotube...
- 202
- 3,203
- 0
CARBON NANOTUBES pot
... field of carbon nanotubes is marked by the publication by Iijima of the observation of multi-walled nanotubes with outer diameters as small as 55 A, and inner diameters as small as 23 A, and a nanotube ... microscopy of carbon nanotubes and nanocones 65 T W EBBESEN and T TAKADA: Topological and SP3 defect structures in nanotubes 71 S IHARA and S ITOH: Helically coiled and torodial cage forms of graphitic ... 1 0a results in a cylinder that has a diameter (ca nm) and a 22-carbon atom repeat cycle and a single hexagon screw pitch -the smallest archetypal (isolated pentagon) example of a graphene nanotube...
- 202
- 1,343
- 0
CARBON NANOTUBES.Elsevier Journals of Related Interest Applied Superconductivity Carbon Journal pdf
... field of carbon nanotubes is marked by the publication by Iijima of the observation of multi-walled nanotubes with outer diameters as small as 55 A, and inner diameters as small as 23 A, and a nanotube ... microscopy of carbon nanotubes and nanocones 65 T W EBBESEN and T TAKADA: Topological and SP3 defect structures in nanotubes 71 S IHARA and S ITOH: Helically coiled and torodial cage forms of graphitic ... 1 0a results in a cylinder that has a diameter (ca nm) and a 22-carbon atom repeat cycle and a single hexagon screw pitch -the smallest archetypal (isolated pentagon) example of a graphene nanotube...
- 202
- 490
- 0
Long run effects of government policy in the growth model with creative destruction
... Physical Capital Accumulation For physical capital accumulation, we assume that each unit of unused final good can be viewed as one unit of physical capital and there is no depreciation Since from ... time paths of variables such as per capita capital asset, leading-edge productivity and variety of intermediate goods 4.1 Steady-State Equilibrium Results of Social Planner’s Economy At any given ... preferable states with maximal social welfare and optimal growth rate in growth theory, because it lacks theoretical guarantee that a decentralized economy will automatically evolve into an optimal...
- 79
- 265
- 0
Tài liệu Telecommuting: will it change the world? Telecommuting will have major effects in the worlds of work pdf
... physical challenges, their motivation can often be higher than a child's Unfortunately, society does not encourage many adults to learn People are busy with families and work, and some adults may ... some of the positive and negative aspects of animal testing Many medical treatments and procedures have been developed from experiments on animals Since animals share many features with humans, ... much of this is social pressure and how much is genetic? I am convinced that while children's brains have a natural ability to absorb new information as part of their developmental growth, much of...
- 9
- 660
- 0
Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx
... region of MAP2 CD2 domain (702–744 aa) in human, mouse and Gallus This supplementary material can be found in the online version of this article Please note: As a service to our authors and readers, ... (catalog number: SC-9996; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), Flag (catalog number: 3165; Sigma-Aldrich) and HA (catalog number: 1867423; Roche Diagnostics, Basel, Switzerland) ... signal transduction pathways [1,2] The kinase noncatalytic C-lobe domain (KIND) was determined to be a putative signaling domain based on bioinformatic analysis of the N-terminal sequence of the...
- 11
- 658
- 0
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx
... was obtained by PCR from the plasmid pET21 SIC1 [32] with a forward primer (5Â-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3Â) designed to introduce a hexahistidine tag and a ClaI ... hexahistidine tag was obtained by PCR using the pET2 1a PNT-H6 plasmid [30] as the template The forward primer (5Â-TACCGTTAACATCGATATGCATCATCATC ATCATCATGC-3Â) was designed to insert a ClaI restriction ... time of up to h (data not shown), whereas both IDPs started to degrade after of tryptic digestion, and were no longer detectable after (Fig 8) A signicant degradation of NTAIL was already apparent...
- 14
- 672
- 0
Tài liệu Báo cáo khoa học: Role of transcription factor activator protein 1 (AP1) in epidermal growth factor-mediated protection against apoptosis induced by a DNA-damaging agent doc
... addition of ADR, and used for immunoblot analysis of pro-caspase and caspase (C) Cells were treated with EGF and ADR as described in (A) Lysates were prepared at the indicated times after the ADR addition ... ADR and collected cell extracts at various time points for the immunoblot analysis of caspase Beginning at h post treatment with ADR, an increase in the amount of the cleaved form of caspase was ... addition and analyzed for caspase activity by using a fluorometric substrate-based assay Each point is the mean of triplicate samples, and the bar represents the standard deviation Similar results...
- 13
- 493
- 0
Tài liệu Economic Reforms, Foreign Direct Investment and its Economic Effects in India pdf
... non-traditional export industries, whereas Japanese FDI has not The extremely short account of India’s reform program draws on Kumar (2003), Balasubramanyam and Mahambare (2003), Agrawal (2005) and Gupta ... University, Cambridge, MA Balasubramanyam, V.N., and V Mahambare (2003) FDI in India Transnational Corporations 12 (2): 45-72 Balasubramanyam, V.N., M .A Salisu and D Sapsford (1996) Foreign Direct ... trade liberalization, financial liberalization and human capital formation in post-reform India and the complementary process of technological diffusion.27 As noted in Table 1, several manufacturing...
- 45
- 513
- 0
Báo cáo "Correlation Effects in Atomic Thermal Vibration of fcc Crystals " pdf
... part by the basic science research project No 41.10.04 and the special research project No QG.05.04 of VNU Hanoi References J M Tranquada and R Ingalls, Phys Rev B 28(1983) 3520 C A Ashley and ... potential characterizing the interaction of each pair of atoms Numerical calculations have been carried out for Cu and Ni The calculated u , σ2 , CR functions and the ratio C R / u2 , C R / σ of ... ; µ= Ma Ms , Ma + Ms (17) where M a and M S are the masses of absorbing and backscattering atoms; and in Eqs (15, 16) u0 , σ2 are the zero point contributions to u2 and σ2 ; ω E , θ E are the...
- 8
- 412
- 0
Permitted water pollution discharges and population cancer and non-cancer mortality: toxicity weights and upstream discharge effects in US rural-urban areas doc
... non-metropolitan areas Death rates for total non-cancer and kidney disease in rural areas that are not adjacent to metropolitan areas are higher in association with greater local and upstream toxicity-weighted ... 3,4,5,6,7,9 and 10), and non-metropolitan areas not adjacent to metropolitan areas (codes 8,11 and1 2) Data sources and variables The EPA’s Discharge Monitoring Report (DMR) database, which includes data ... the measure of carcinogen releases instead of the non-carcinogen releases added substantial explanatory ability to the model, as well as areas in the Northern Plains and New England, which showed...
- 15
- 522
- 0
Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt
... purification of MAO A The gene encoding human liver MAO A was amplified from a cDNA clone obtained from MRC Geneservices (Cambridge, UK) using the primers 5¢-GTCTTCGAA ACCATGGAGAATCAAGAGAAGGCGAGTATCGCGG ... G-3¢ and 5¢-GAGAGCTCGAGAACAGAACTTCAAGAC CGTGGCAGGAGC-3¢ The NcoI and XhoI sites used for further cloning are shown underlined The amplified DNA was first cloned into pGem-T Easy (Promega, Madison, ... in MAO A R V Dunn et al Fig S5 Substrate dependence of the reductive halfreaction of MAO A- catalysed oxidation of PEA at pH 8.5 and 20 °C This material is available as part of the online article...
- 9
- 327
- 0
Báo cáo khoa học: Crosstalk between Src and major vault protein in epidermal growth factor-dependent cell signalling docx
... immunoblotting was from Santa Cruz Biotechnology Inc (Santa Cruz, CA) Rabbit muscle enolase for in vitro Src kinase assay, anti-FLAG monoclonal antibody and anti-FLAG M2 agarose were from Sigma (St Louis, ... The activity of Src is strongly associated with malignant phenotype changes [35–38], and increased expression or activity of Src correlates with the stage and metastatic potential of some neoplasia ... was performed using the same Src kinase assay as in (A) , without enolase The result indicates that MVP is a substrate of Src tyrosine kinase in vitro as well indicated time periods, cell lysates...
- 12
- 353
- 0
Programme Curriculum for Master Programme in Economic Growth, Innovation and Spatial Dynamics docx
... judgement, evaluation and analysis of economic facts and ideas, and good communication skills Graduates of this programme are particularly equipped for analytical and planning work in government and international ... field of Economic Growth, Innovation and Spatial Dynamics, taking into account relevant scientific, social and ethical aspects, and demonstrate an awareness of ethical aspects of research and development ... processes of innovation and entrepreneurship Skills and abilities - demonstrate an ability to critically and systematically integrate knowledge and to analyse, assess and deal with complex phenomena,...
- 10
- 749
- 0
The Role of Education Quality in Economic Growth* pdf
... increase in productive human capital as a year of schooling in Japan Additionally, this measure assumes that formal schooling is the primary (sole) source of education and, again, that variations ... significantly between the two groups of 46 The regions are East Asia, South Asia, Latin America, Middle East and North Africa, Sub-Saharan Africa, and the industrial countries 47 The proxy for openness ... risk), as used by Acemoglu, Johnson, and Robinson (2001) and provided in McArthur and Sachs (2001) This measure of the risk of confiscation and forced nationalization of property is often used as a...
- 96
- 776
- 1
A study in the growth mechanism of silicon nanowires with or without metal catalyst
... Metal- assisted growth of SiNWs A basic aspect of the VLS mechanism is the metal particle acting as a catalyst for the anisotropic growth of SiNW with a crystalline structure A catalyst particle ... feasible to react with H2O (Eq (7)) The above factors easily cause a low-crystal quality of as- received SiNWs even amorphous SiO2 nanowires 3.3 Advantage and disadvantage of with and without metal ... pressure was used, plenty of Si atoms will be flowed away and have no time to contact Fig A) Binary phase diagram of Au and Si B) A mode of VLS mechanism J.-J Niu, J.-N Wang / Materials Letters...
- 5
- 576
- 0
Single electron effects in highly doped polysilicon nanowires
... the drain current of the nanowires as a function of applied source–drain bias VSD , of a sidegate voltage VSG , of temperature T and of the magnetic ÿeld B Fig 3 (a) shows the conductance of a 25 ... other hand, both electronic activation of the dopant atoms as well as the electronic quality of the nanocrystals increases with higher annealing temperature Therefore, in our investigations we ... ÿlm In Fig 1 (a) the AFM-image of the surfaces of an ion-implanted but not yet annealed a- Si ÿlm is shown Fig 1(b) shows the surface annealed for 30 s at a ◦ temperature of 1000 C Nanometer sized...
- 5
- 203
- 0
Báo cáo khoa học: Cholinoceptive and cholinergic properties of cardiomyocytes involving an amplification mechanism for vagal efferent effects in sparsely innervated ventricular myocardium ppt
... (forward), 5¢-ACAAGGAAGGATAGTGAAGCC-3¢; m2 (reverse), 5¢-CATCTCCATTCTGACCTGAAG-3¢; m5 (forward), 5¢-TCTGTTCAGATCCTGCTTG-3¢; m5 (reverse), 5¢-TGCTGGAGACAGAAGGTAGT-3¢; a3 (forward), 5¢CAGAGTCCAAAGGCTGCAAG-3¢; ... CCAAUCGCUGGUACGACAAGU; and ChAT siRNA (antisense), UUGUCGUACCAGC GAUUGGCC A nonspecific siRNA was used as a negative control for comparison: unrelated siRNA (sense), GUACCGCACGUCAUUCGUAUC; and unrelated siRNA (antisense), ... filtered through a membrane filter with a molecular mass cut-off of 10 000 Da (UFC3LGC00; Millipore, Bedford, MA, USA) The filtrate was sampled for ACh assay A quantitative analysis of ACh was conducted...
- 15
- 386
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25