prbp pdedelta is a 17 kda prenyl binding protein closely related to unc119 and rhogdi

Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt

Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt

Ngày tải lên : 16/03/2014, 06:20
... complementary (5¢-CACCGCAGTGCCATGGAAGGAGTTTC CACACGAATGTGGAAACTCCTTCCATGGCACTG-3¢) according to the manufacture’s protocol (Invitrogen, Carlsbad, CA, USA) Transfections with various DNA constructs ... F-actin in a direct manner Formation of higher order actin structures, such as bundles and cables, is crucial to stabilize the organization of transvacuolar strands and maintain overall cellular ... mutations into each LIM domain: LIM1(10Cys fi Ser, 13Cys fi Ser):5¢-GGA GGCGCAAAATCTGGAGCCTCTGAAAAGACCGTCTA C-3¢; LIM2(120Cys fi Ser, 123Cys fi Ser): 5¢-GAGAGTCC GAGAAGTCCCCTCGATCTGGCAAGTCAGTCTATG-3¢...
  • 11
  • 347
  • 0
A study of linguistic features of proverbs related to gain and loss in English versus Vietnamese

A study of linguistic features of proverbs related to gain and loss in English versus Vietnamese

Ngày tải lên : 13/09/2015, 00:17
... that is used as the language of aviation, international sport and pop music It is also the English language that is used as an official language in 44 countries, and as the language of business, ... perceive and use proverbs Proverbs are considered to be special factors of a language’s vocabulary system because they reflect cultural special characteristics of each nation, including material and ... 100% Total 18 4.2.3 Semantic Similarities and Differences of Proverbs Relating to Gain and Loss in English and Vietnamese a Similarities It can be clearly seen that both English and Vietnamese...
  • 26
  • 484
  • 1
Báo cáo Y học: Identification and characterization of a novel activated RhoB binding protein containing a PDZ domain whose expression is specifically modulated in thyroid cells by cAMP pot

Báo cáo Y học: Identification and characterization of a novel activated RhoB binding protein containing a PDZ domain whose expression is specifically modulated in thyroid cells by cAMP pot

Ngày tải lên : 23/03/2014, 21:20
... Okawa, K., Iwamatsu, A. , Fujita, A. , Watanabe, N., Saito, Y., Kakizuka, A. , Morii, N & Narumiya, S (1996) The small GTP -binding protein Rho binds to and activates a 160 kDa Ser/Thr protein kinase ... Madaule, P., Reid, T., Ishizaki, T., Watanabe, G., Kakizuka, A. , Saito, Y., Nakao, K., Jockusch, B.M & Narumiya, S (1997) p140mDia, a mammalian homolog of Drosophila diaphanous, is a target protein ... Biol 17, 2247–2256 13 Watanabe, G., Saito, Y., Madaule, P., Ishizaki, T., Fujisawa, K., Morii, N., Mukai, H., Ono, Y., Kakizuka, A & Narumiya, S (1996) Protein kinase N (PKN) and PKN -related protein...
  • 9
  • 394
  • 0
Characterization of a novel 24 kda hemin binding protein, hmuy, in porphyromonas gingivalis w50

Characterization of a novel 24 kda hemin binding protein, hmuy, in porphyromonas gingivalis w50

Ngày tải lên : 03/10/2015, 20:32
... 5’-CCGGGATCCATGAAAAAAATCAT-3’ hmuY_XhoI_Rev 5’-AATCTCGAGTTATTTAACGGGGTA-3’ hmuY_BamHI_Fwd 5’-CGCGGATTCATGGCTCTTCACCGCTATGA-3’ hmuY_XhoI_Rev 5’-AATCTCGAGTTATTTAACGGGGTA-3’ ermF_ClaI_Fwd 5'- CCATCGATGGGATAGCTTCCGCTATTGC-3' ... genetic arrangement of ragAB locus is also similar to those transport systems for transferrin and lactoferrin in Neisseria and Haemophilus sp where a lipoprotein is usually co-transcribed with a TonB-linked ... (Abiko et al., 1990) HBP35 protein was found to function as a coaggregating factor toward Actinomyces viscosus and appears to confer colonizing ability to P gingivalis (Hiratsuka et al., 1992)...
  • 170
  • 198
  • 0
Tài liệu Báo cáo khoa học: Structure of the putative 32 kDa myrosinase-binding protein from Arabidopsis (At3g16450.1) determined by SAIL-NMR docx

Tài liệu Báo cáo khoa học: Structure of the putative 32 kDa myrosinase-binding protein from Arabidopsis (At3g16450.1) determined by SAIL-NMR docx

Ngày tải lên : 18/02/2014, 14:20
... of PA-oligosaccharides, GalNAca1-3(Fuca1-2)Galb1-3(Fuca1-4)GlcNAcb1-3Galb14Glc-PA and Neu5Aca2-6Galb1-4GlcNAcb1-2Mana16(Neu5Aca2-3Galb1-3(Neu5Aca2-6)GlcNAcb1-4(Neu5Aca26Galb1-4GlcNAcb1-2)Mana1-3)Manb1-4GlcNAcb1-4GlcNAc-PA ... Major natural location PA sugars that showed affinity for At3g16450.1 (Glca1-4Glc)3 maltohexaose (Glca1-6Glc)3 isomaltohexaose Gala1-4Galb1-4Glc GalNAca1-3(Fuca1-2) Galb1-3(Fuca1-4)GlcNAcb1-3Galb1-4Glc ... Tetrasialyl PA glycan Neu5Aca2-6Galb1-4GlcNAcb1-2Mana1-6(Neu5Aca2-3Galb1-3(Neu5Aca2-6)GlcNAcb1-4(Neu5Aca2-6Galb14GlcNAcb1-2)Mana1-3)Manb1-4GlcNAcb1-4GlcNA-PA was used as a control sugar to determine...
  • 12
  • 579
  • 0
Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf

Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf

Ngày tải lên : 06/03/2014, 00:20
... CGGGGATCCGCATCGGAACAAAACAATAC AATCCCGGGTTACTTTAGTTTATCTTTGCCG GGGGGATCCGGTACAGATGTAACAAATAAAG ATTCCCGGGTAATTTTTCCAAGTTAAATTACTTG GGGGGATCCGGTACAGATGTAACAAATAAAG CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA ... CCCGGATCCTATTTAGGTGGAGTTAGAGATAAT AATCCCGGGTTACTTTAGTTTATCTTTGCCG GAATTATCTTTAGCTCTAGCTATTGATCC GGATCAATAGCTAGAGCTAAAGATAATTC GCAGAATTCGTCGGCTTGAAATACGCTG AATGGATCCTTACTTTAGTTTATCTTTGCCG CCCAAGCTTGATGATGTCAGC ... virulence factors that allow S aureus to adhere to the surface of host cells and to damaged tissue, and help it to avoid phagocytosis by neutrophils [3,4] The fibronectin -binding proteins (FnBPs) A and...
  • 13
  • 514
  • 0
Báo cáo khoa học: A DmpA-homologous protein from Pseudomonas sp. is a dipeptidase specific for b-alanyl dipeptides Hidenobu Komeda and Yasuhisa Asano docx

Báo cáo khoa học: A DmpA-homologous protein from Pseudomonas sp. is a dipeptidase specific for b-alanyl dipeptides Hidenobu Komeda and Yasuhisa Asano docx

Ngày tải lên : 07/03/2014, 21:20
... L-Ala-(Gly)2 (L-Ala)2, L-Ala-D-Ala, L-Ala-D-Ala-L-Ala, DL-Ala-DL-Asn, DL-Ala-DL-Ile, DL-Ala-DL-Leu, DL-Ala-DL-Met, DL-AlaDL-Phe, DL-Ala-DL-Ser, DL-Ala-DL-Val, L-Asp-D-Ala, L-Pro-Gly, L-ProL-Phe, c-Aminobutyryl-L-His ... L-Ala-pNA D-Ala-NH2 L-Ala-NH2 D-Ala-(Gly)2 L-Ala-(Gly)2 b-Ala-L-Ala b-Ala-Gly b-Ala-NH2 b-Ala-L-His (Carnosine) b-Ala-L-Leu (b-Ala)2 similarity to that from dmpA of O anthropi LMG7991 DmpA has been ... Pseudomonas aeruginosa and Lactobacillus delbrueckii ssp lactis DSM 7290 Van der Drift and Ketelaars have isolated a bacterium hydrolyzing b-Ala-l-His (l-carnosine) and identified it as P aeruginosa...
  • 10
  • 406
  • 0
Báo cáo khoa học: Identification of a 250 kDa putative microtubuleassociated protein as bovine ferritin Evidence for a ferritin–microtubule interaction pdf

Báo cáo khoa học: Identification of a 250 kDa putative microtubuleassociated protein as bovine ferritin Evidence for a ferritin–microtubule interaction pdf

Ngày tải lên : 23/03/2014, 13:20
... 250 kDa protein; and lane M, molecular mass standards (myosin heavy chain, 220 kDa; myosin light chain 1, 26 kDa; myosin light chain 2, 18 kDa) (B) Immunocrossreactivity: monomeric 250 kDa protein ... storage and uptake activity of the 250 kDa protein (A) Detection of iron in the 250 kDa protein: potassium ferrocyanide was added to a final concentration of 10 mM to all of the fractions obtained ... R Hasan et al with an approximate molecular mass of 250 kDa, was reported as a putative MAP, on the basis of various properties such as electrophoretic mobility, heat stability and immunoreactivity...
  • 10
  • 232
  • 0
Báo cáo khoa học: Heteromer formation of a long-chain prenyl diphosphate synthase from fission yeast Dps1 and budding yeast pptx

Báo cáo khoa học: Heteromer formation of a long-chain prenyl diphosphate synthase from fission yeast Dps1 and budding yeast pptx

Ngày tải lên : 30/03/2014, 04:20
... cerevisiae to products of autoxidized polyunsaturated fatty acids Proc Natl Acad Sci USA 93, 7534–7539 Suzuki K, Okada K, Kamiya Y, Zhu X, Tanaka K, Nakagawa T, Kawamukai M & Matsuda H (1997) Analysis ... CGAATTCTTACTTTCTTCTTGT CAGTGAATTCGAGCTCGGTACCC ATACATACTGAATCATCATCTCCTTC GAG ATGATTCAGTATGTAT ATAAGGCGCATTTTTCTTCAAAGCTTTCAC TTCTTTCTCG to generate pBSSK-COQ1 For the expression of COQ1 in fission yeast, the ... J Bacteriol 179 , 5992–5998 20 Okada K, Kainou T, Tanaka K, Nakagawa T, Matsuda H & Kawamukai M (1998) Molecular cloning and mutational analysis of the ddsA gene encoding decaprenyl diphosphate...
  • 16
  • 315
  • 0
Báo cáo khoa học: " Proteomics computational analyses suggest that the bornavirus glycoprotein is a class III viral fusion protein (γ penetrene)" pot

Báo cáo khoa học: " Proteomics computational analyses suggest that the bornavirus glycoprotein is a class III viral fusion protein (γ penetrene)" pot

Ngày tải lên : 12/08/2014, 04:20
... NP042023) Additional bornavirus G sequences used in the analyses included ABH0 3174 , CAC70658 (horse), AAL49985 (sheep), ABH03169 (rabbit), ACG59352 (avian - Aratinga solstitialis), and AAA91195 (human) ... Carbone KM, Duchala CS, Griffin JW, Kincaid AL, Narayan O: Pathogenesis of Borna disease in rats: evidence that intraaxonal spread is the major route for virus dissemination and the determinant ... Rhabdoviridae G class III F Paramyxoviridae HA TPMV-like class henipa class I I Paramyxovirinae pre class I, II, III Pneumovirinae F HA class class I I Paramyxoviridae avula metapneumo Mononegavirales...
  • 10
  • 335
  • 0
Báo cáo sinh học: " A DNA vaccine against tuberculosis based on the 65 kDa heat-shock protein differentially activates human macrophages and dendritic cells" pot

Báo cáo sinh học: " A DNA vaccine against tuberculosis based on the 65 kDa heat-shock protein differentially activates human macrophages and dendritic cells" pot

Ngày tải lên : 14/08/2014, 19:22
... We also thank Mrs Izaíra T Brandão and Mrs Ana P Masson for technical assistance This study was supported by grants from Fundação de Amparo Pesquisa Estado de São Paulo (FAPESP), Programa Nacional ... beta-actin was detected by PCR using cDNA and betaactin-specific primers (sense 5' ATGTTTGAGACCTTCAACA-3' and antisense 5'-CACGTCAGACTTCATGATGG-3'; giving a 495-bp band) The PCR products were visualised ... amplification was carried out using μL of cDNA preparation and specific primer pairs of M leprae Hsp65 (sense 5'-TCAAGGTGGCGTTGGAAGC-3' and antisense 5'-CCGTGACCCACTGAAAGGTTA-3'; giv- Page of 11 (page...
  • 11
  • 313
  • 0
Renewable energy is a challenge, but also an opportunity for new industries, employment, and new ways to reduce dependency on fuel imports, provide electricity to poor remote areas, reduce air pollution

Renewable energy is a challenge, but also an opportunity for new industries, employment, and new ways to reduce dependency on fuel imports, provide electricity to poor remote areas, reduce air pollution

Ngày tải lên : 08/09/2015, 23:32
... the analysis On this basis, the theoretical installed wind capacity potential for Cambodia, the Lao PDR, Myanmar, Thailand, and Viet Nam was estimated to be 888 gigawatt (GW), and the theoretical ... sector Inadequate or limited access to capital, as well as lack of technical and financial support Lack of a mandatory policy for use of biofuels and lack of specific targets on production and ... Potential of Agricultural Residues: Thailand 7.7 Land Requirement for Palm Oil as Biodiesel Feedstock: Thailand 7.8 Land Requirement for Sugarcane as Bio-Ethanol Feedstock: Thailand 7.9 Land...
  • 168
  • 633
  • 0
A STUDY ON TRANSLATION OF ENGLISH TERMINOLOGIES RELATED TO WATER SECTOR

A STUDY ON TRANSLATION OF ENGLISH TERMINOLOGIES RELATED TO WATER SECTOR

Ngày tải lên : 11/12/2013, 23:55
... same message in another language The text to be translated is called the "source text," and the language that it is to be translated into is called the "target language"; the final product is ... translation is that the text in TL sounds more natural On the contrary, the disadvantage is that translating is too casual to understand the original because of its freedom ◊ Adaption: This is the ... terminology databases especially appropriate In his book Technical Translation, Jody Byrne argues that technical translation is closely related to technical communication and that it can benefit...
  • 73
  • 428
  • 0
A STUDY ON TRANSLATION OF ENGLISH TERMS RELATED TO WEATHER FORECAST

A STUDY ON TRANSLATION OF ENGLISH TERMS RELATED TO WEATHER FORECAST

Ngày tải lên : 11/12/2013, 23:55
... „Typically, formal correspondence distorts the grammatical and stylistic patterns of the receptor language, and hence distorts the message, so as to cause the receptor to misunderstand or to labor ... (Nida and Taber, 1982:200) Nida (1964) distinguishes formal equivalence and dynamic translation as basic orientations rather than as a binary choices: Formal equivalence is achieved when the SL and ... study This research is carried out with view to help learners enlarge their vocabulary and have general understanding about translation and translation of the astronomy and geography terms All of...
  • 55
  • 560
  • 0
Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc

Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc

Ngày tải lên : 16/03/2014, 16:20
... hyperthemophilic bacteria Aquifex aeolicus, Thermotoga maritima and Thermoanaerobacter tengcongensis not encode a protein related to bacterial DsbA and no DsbA-like protein in Archaea were found, ... Hosoyama, A. , Fukui, S., Nagai, Y., Nishijima, K., Otsuka, R., Nakazawa, H., Takamiya, M., Kato, Y., Yoshizawa, T., Tanaka, T., Kudoh, Y., Yamazaki, J., Kushida, N., Oguchi, A. , Aoki, K., Masuda, S., ... 49 Kawarabayasi, Y., Hino, Y., Horikawa, H., Yamazaki, S., Haikawa, Y., Jin-n., o, K., Takahashi, M., Sekine, M., Baba, S., Ankai, A. , Kosugi, H., Hosoyama, A. , Fukui, S., Nagai, Y., Nishijima,...
  • 12
  • 506
  • 0
báo cáo sinh học:" A model linking clinical workforce skill mix planning to health and health care dynamics" pot

báo cáo sinh học:" A model linking clinical workforce skill mix planning to health and health care dynamics" pot

Ngày tải lên : 18/06/2014, 17:20
... and classified diseases and disabilities which may affect human beings for example the entities listed in the items listed in the International Statistical Classification of Diseases and Related ... on the health and function (that is, disease and disability prevalence) of the population [26] Closing the loop to show how 'Health Impact' and 'Health and Function' affect the inflows and outflows ... with disabilities, and some with disease, thus generating the need for clinical health care For a range of reasons including personal choice, fears and prejudice, geographic and financial accessibility,...
  • 10
  • 398
  • 0
Báo cáo y học: "Prediction of prognostic biomarkers for Interferon-based therapy to Hepatitis C Virus patients: a metaanalysis of the NS5A protein in subtypes 1a, 1b, and 3a" doc

Báo cáo y học: "Prediction of prognostic biomarkers for Interferon-based therapy to Hepatitis C Virus patients: a metaanalysis of the NS5A protein in subtypes 1a, 1b, and 3a" doc

Ngày tải lên : 12/08/2014, 04:20
... discussions and help Special thanks to Ali Khalifa, Mona Kamar, and Nafisa Hassan for their efforts and help through this paper Author Details 1Informatics and Systems Department, Division of Engineering ... Collection and Analysis We downloaded all available annotated HCV NS 5A sequences from subtypes 1a, 1b, and 3a from the HCV LANL database [16] (See Table 1) Factors affecting the response to therapy ... interpretable set of rules than traditional classification approaches [28,29] Analysis of the genetic distance variations, VESPA, and relative Shanon entropy (Table 1, Figure and Additional files and...
  • 9
  • 213
  • 0

Xem thêm