... Developing a natural language interface to complex data ACM Tr(uts on D=t~bsse ~l/stsrrts, (1978), 2, pp 105-147 I BaUard, B A "Domain Class" approach to transportable natural language processing ... language question answering system for a large relational database Cowzm A C M 21 (1978), 7, pp 526-539 22 Woods, W Semantics and quantification in natural language question answering In Advances ... N A phrase-structured grammatical formalism for transportable natural language processing, llm~r J Cow~p~t~zt~na~ L~n~ist~cs, to appear 24 Ginsparg, J A robust portable natural language data...
... understanding of ADJECTIVES and PREPOSITIONS afraid of angry at aware of capable of careless about familiar with fond of happy about interested in jealous of made of married to proud of similar to sorry ... prepositions in idiomatic usage would require volumes, andtheonly way English language learners can begin to master the intricacies of preposition usage is through practice and paying close attention ... about think about trust in work for worry about A combination of verb and preposition is called a phrasal verb Thewordthat is joined to the verb is then called a particle Please refer to the brief...
... ma a glass of wine “Would you like a glass of wine?”, he said 28 They changed their plan because the weather was bad Due to bad weather, they changed their plan 29 The increasing number of cars ... “Don’t walk on the grass”, the gardener said to us The gardener told us not to walk on the grass 21 Somebody repaired her car yesterday She had her car repaired 22 You must see the manager tomorrow ... worth trying to make her change her mind There’s no point trying to make her change her mind 17 He was driving very fast because he didn’t know the road was icy If he had known the road was icy,...
... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia, ... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn,...
... by the leaf area Roughly, the plant height increased until 120 days after transplantation, and thereafter a constant height was maintained in every case The leaf area index (LAI), however, increased ... to calculate the decrease inthe ratio of the rice assimilation amount to the total nitrogen inflow that occurs with the increase inthe water supply rate inthe pots The mathematical model and ... shown in Fig Inthe 0.6 m3/(m2∙day) case, the water level was increased from early October, and clogging was presumed However, the discharge rate was maintained, and we concluded thatthe effect...
... thermal scansheating/cooling, and isothermal cycles), a pressure (stable) and an atmosphere (inert or reactive) Principally, sample and reference are maintained at the same temperature, while any ... sample The change of a crystals size anda form during the annealing can be revealed by a X-Ray analysis but the change inthe percentage of crystalline phase is detectable also by the DSC analysis ... Romanini, Mauricio Javier Braia and Mar a Cecilia Porfiri Chapter Insights into the Relative DNA Binding Affinity and Preferred Binding Mode of Homologous Compounds Using Isothermal Titration Calorimetry...
... and observed thatthe genes PA0266 and PA0265 work as 5-aminovalerate aminotransferase and glutarate semialdehyde dehydrogenase, catalyzing successive chemical reactions from 5-amino pentanoate ... predicting PA0266 as a putative 5-aminovalerate aminotransferase and PA0265 as a putative glutarate semialdehyde dehydrogenase Recently, a report has suggested candidate genes for 5-aminovalerate aminotransferase ... aminotransferase and glutarate semialdehyde dehydrogenase inthe lysineA PA0266 2-Oxoglutarate B PA0265 Glutarate semialdehyde 5-Aminovalerate NADP+ Glutamate NADPH Absorbance at 340 nm 0.20 a...
... TOBIAS H COLDING AND WILLIAM P MINICOZZI II To achieve this, we will solve two Plateau problems using Σ as a barrier and then use the fact that Σ3 separates y1 , y2 near y to get that these are in ... proportional to max |A| B Such a potentially small N -valued graph sitting inside Σ can then be seen to extend as an N -valued graph inside Σ almost all the way to the boundary That is, the small N -valued ... understanding such surfaces is to understand the local structure ina ball andin particular the structure of an embedded minimal disk ina ball in R3 (with the flat metric) This study is undertaken...
... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC AATTAACCCTCACTAAAGGG ... ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ... the amino acids at positions andina model substrate protein having a sequence MGAAAAAAAA at its N-terminus was performed andthe susceptibility of these mutants to protein N-myristoylation was...
... 23 Individual- and household-level variables are also presented in Appendix Tables and 10 They consist of age and sex of the index child, mother=s and father=s education and age, and mother's ... 150) also has a positive influence on modern private and public demand, indicating that this variable may capture accumulated human capital and family background characteristics of the mother ... the data andthe resulting parameter estimates are saved as a data set Using the collection of estimated parameter sets from these replications, one can calculate the standard deviation of each...
... relevant intellectual content LB performed all the measurements and was involved in drafting the manuscript CP and AF participated in data acquisition and analysis SG gave final approval of the version ... test and chair-stand test Disability was assessed using selfreport instruments: the Barthel Index [63] andthe Nottingham Extended Activities of Daily Living (ADL) Index [64] The clinical evaluation ... metatarsal head, right fifth metatarsal head, left fifth metatarsal head During posture analysis, in order to relate the displacement of the marker arrays to theposition of the 3D underlying...
... strengthened the evidence thatthe mass media is making the desired impact with regard to information about HIV/AIDS in Nigeria The impact of healthcare providers/institutions inthe dissemination ... for screening voluntarily or acknowledging their HIV status It was not surprising, therefore, thatthe majority of the patients said thatthey would maintain secrecy should any of their family members ... sexual behaviors, and condom use Data Analyses The data were analyzed using the Statistical Package for Social Sciences (SPSS), version 10.[15] All statistical tests were at 5% probability level...
... comparative purposes The implementation of such an approach has limitations inthat it requires a substantial (and continuing) investment in quality control, training and access to a central facility ... examination of the patterning inthe residuals andthe magnitude of the fist residual component ina Principal Component Analysis of the residuals This analytical strategy has been described in ... RSM [35] and suggested a five-category scale Claesson and Svensson [36] used the rank-invariant statistical method and suggested a scale reduced to four categories, as did also Heinemann and coworkers...
... for radiata pine slash needles and twigs incubated inthe thinned stand andinthe prepared and unprepared plots after clear-felling indicates that initial levels of N in decomposing material were ... year ina thinned stand andin an adjacent clear-cut area Inthe latter, the effect of intensive site preparation involving logging residue incorporation to the mineral soil was compared with the ... substantially following clear-cutting Thus, the mean daily temperatures inthe Table III Annual accumulation, return, leaching and uptake of the radiata pine stand For leaching, values in brackets...
... halepensis inthe semi-arid climate of southeast Spain The addition of USR enhanced plant growth in all the treatments Roldán and Albaladejo (1994) demonstrated thatthe application of small amounts ... mechanical terraces, the organic amendment was incorporated into the top 30 cm of the whole terrace using a rotovator Inthe manual terraces, the refuse was only incorporated into the planting holes ... the Carrascoy range in Murcia Province (southeast Spain) The climate is semi-arid Mediterranean, with extremely hot and dry summers The average annual rainfall is 300 mm, occurring mostly in autumn...
... from the prolactine producing pituitary adenoma, the hyperplasia of the parathyroid glands andthe well-differentiated non functioning pancreatic endocrine carcinoma, functioning bilateral adrenocortical ... tumor inthe body and tail of the pancreas and (iv) functioning bilateral adrenal tumors, was established The patient was submitted to an exploratory laparotomy through a bilateral subcostal incision ... excessive amounts of hormones such as gastrin, insulin, glucagon, somatostatin, neurotensin or vasoactive intestinal polypeptide and are associated with distinct clinical syndromes [2] Pancreatic...
... populations from the US, Canada and Spain, and nearly identical to data reported from Great Britain and New Zealand [5-10] However, the carrier frequency of the 1858T allele in RA patients was ... immunogenetic associations in male and female RA patients have also been described for several HLA DRB1 alleles [28,29] One possible explanation of these findings is that male and female RA are partially ... declare thatthey have no competing interests Authors' contributions MP designed the study, oversaw all aspects of the laboratory work, analyzed the data and prepared the manuscript SK, SA, MW and...
... centrifugation at 14,000 rpm for 15 minutes to separate into an aqueous RNA phase, an organic protein layer anda DNA interphase RNA was extracted by adding 0.5 ml isopropanol to the aqueous phase and ... work including all the molecular analyses JS participated inthe field work; GM and SEM participated in drafting the manuscript All authors read and approved the final manuscript Competing interests ... Ginde AA, Mansbach JM, Camargo CA Jr: Association between serum 25hydroxyvitamin D level and upper respiratory tract infection inthe Third National Health and Nutrition Examination Survey Arch...