pass two dimensional char array to function in c
Báo cáo Y học: Dystrobrevin requires a dystrophin-binding domain to function in Caenorhabditis elegans doc
Ngày tải lên :
08/03/2014, 23:20
... involved in the interaction with Dys-1 in vitro Within this domain, the first half seems to be particularly critical as deletions infringing on this side lead to a decrease in binding Constructs ... amino acids (Fig 5), rescue of dyb-1(cx36) animals still occurred in two out of three lines transgenic lines (Table 1), which indicates that removing introns and did not impair the rescuing capacity ... Dyb-1 for in vitro binding experiments Deletions were carried out on the dyb-1 coding sequence, using clone AN450 [encoding Dyb-1 amino acids 390–543 fused in frame to the GST coding sequence; plasmid...
- 6
- 334
- 0
báo cáo khoa học: " Evaluation of protein pattern changes in roots and leaves of Zea mays plants in response to nitrate availability by two-dimensional gel electrophoresis analysis" pdf
Ngày tải lên :
12/08/2014, 03:21
... http://www.biomedcentral.com/1471-2229/9/113 Figure Total proteins, amino acids, reducing sugars, sucrose and chlorophyll content Total proteins, amino acids, reducing sugars, sucrose and chlorophyll content Time course ... of PCA and then centrifuged again in the same conditions KOH was added to the collected supernatant (to pH 7.6) to remove excess PCA Reducing sugars were measured according to the colorimetric ... of GF14-12, for which the functional information are still lacking Thiamine (i.e vitamin B1) is required in many pathways, such as the Calvin cycle, the branched-chain amino acid pathway and pigment...
- 17
- 325
- 0
Báo cáo y học: " Identification of two distinct structural regions in a human porcine endogenous retrovirus receptor, HuPAR2, contributing to function for viral entry" docx
Ngày tải lên :
13/08/2014, 05:21
... 5'-CCAGCTTTGGGCTGAATGGAACAAAAACTTATTTCTGAAGAA GATCTGATGGCAGCACCCACG 3' and 5'-CGTGGGTGCTGCCATCAGATCTTCT TCAGAAATAAGTTT TTGTTCCATTCAGCCCAAAGCTGG-3' MuPAR regions were introduced into the c- myc HuPAR2 or HuPAR2eGFP backbone ... and 5'-GACCCAGGAAGAAAGACCGTAAG-3' (reverse); HuPAR2 probe, 5'-FAM TTCCTGAGCCACCTGCCACCTCCT BHQ3' Final reaction concentrations were 200 nM probe and 300 nM primers in 20 μl total reaction volume ... 5'-FAM TTCTTGAGCCACCTGCCACCTCGC BHQ-3' Underlined nucleotides represent differences between HuPAR1 and HuPAR2 in this region HuPAR2 primers and probe used were 5'-GCCTGTTGTACCTCTAATGTCACT-3' (forward)...
- 15
- 330
- 0
Báo cáo y học: "Segment-orientated analysis of two-dimensional strain and strain rate as assessed by velocity vector imaging in patients with acute myocardial infarction"
Ngày tải lên :
25/10/2012, 11:15
... Global longitudinal strain measured by two- dimensional speckle tracking echocardiography is closely related to myocardial infarct size in chronic ischaemic heart disease Clin Sci (Lond) 2007; ... stenosis during the further clinical course Basic clinical data are listed in Table Table 1: Basic clinical characteristics Gender (male/female) Age (years) Height (cm) Weight (kg) BMI (kg/m2) ECG (STEMI/NSTEMI) ... strict protocol we had to exclude segments in which the tracking failed (feasibility 71%) One could also criticize the intra-individual comparison instead of considering a control group In our...
- 8
- 683
- 0
How to pass the GMAT unbeatable preparation for success in the graduate management admission test
Ngày tải lên :
13/02/2014, 23:28
... in banking and finance? Key 4.6 Corporations active in banking and finance 4.4 4.2 Corporations active in all other sectors 4.0 3.8 3.6 3.4 3.2 2002 2003 2004 Increases in receipts of Corporation ... allowed to take very much into the test room They provide you with everything you need or are allowed, including scrap, or scratch paper, for doing rough work You are not allowed to bring a calculator ... but since 1997, it has been taken in its current CAT format at a computer screen The test is currently administered by ETS, Educational Testing Services, based in Princeton, New Jersey in the...
- 289
- 1.3K
- 0
Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf
Ngày tải lên :
18/02/2014, 16:20
... Metabolic gene switching in murine female heart function [8] Likewise, high fatty acid oxidation rates in the diabetic heart results in reduced cardiac efficiency [9] In addition to its cytoplasmic ... (2001) Intrinsic diurnal variations in cardiac metabolism and contractile function Circ Res 89, 1199–1208 19 Sordahl LA, Besch HR Jr, Allen JC, Crow C, Lindenmayer GE & Schwartz A (1971) Enzymatic ... Sack MN (2004) Hypoxia-induced decrease 5284 of UCP3 gene expression in rat heart parallels metabolic gene switching but fails to affect mitochondrial respiratory coupling Biochem Biophys Res Commun...
- 7
- 582
- 0
Báo cáo khoa học: "A Grammatical Approach to Understanding Textual Tables using Two-Dimensional SCFGs" docx
Ngày tải lên :
08/03/2014, 02:21
... USA, 2002 ACM Press Conclusion We have introduced a framework to support a more linguistically-oriented approach to finer interpretation of tables, using two- dimensional stochastic CFGs with Viterbi ... likely interpretation was predicted even without access to speci c lexical knowledge We aim to show that a fairly useful baseline level of semantic interpretation accuracy can already be achieved, ... unable to show both physical structure and the semantics of a table at the same time in a hierarchical manner In contrast, information such as “a data block contains three rows of data cell” can...
- 8
- 482
- 0
Base Tutorial: From Newbie to Advocate in a one, two... three! pot
Ngày tải lên :
17/03/2014, 00:20
... if you want to have access to expanded character sets: Chinese or Arabic characters, accented vowels (diacritics) and things like that Protocols that allow for lager numbers of characters have ... deciding on class structure (which classes to work with and which attributes to record in each) and the structure of connections they establish (which table connects with which and with what cardinality) ... will have to conform to the conventions imposed by the software that we are using To be clear, Base using the HSQL engine can accept spaces and other special characters as valid characters for...
- 189
- 1.6K
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
Ngày tải lên :
18/06/2014, 16:20
... exposing CD4+ T cells to both IL-2 and rapamycin in vitro leads to an increase in the cellular frequency of FOXP3+ T cells, originating from nTreg cells and de novo induced Treg cells [91] Clinical ... apoptosis due to a deficiency of IL-2 in inflammatory sites [10] Hence, IL-2 may function as critical an anti-apoptotic factor for Treg cells Evidence of Treg deficiencies in human T1 D It is unclear ... including CD4+ regulatory T cells (T reg) cells [2] These cells constitute 1-10% of * Correspondence: ciro.piccirillo@mcgill.ca † Contributed equally FOCIS Center of Excellence, Research Institute...
- 12
- 573
- 0
báo cáo hóa học: " A prospective study of decline in lung function in relation to welding emissions" pdf
Ngày tải lên :
20/06/2014, 00:20
... http://www.occup-med.com/content/3/1/6 atory volume in one second (FEV1) and forced expiratory capacity (FVC) were recorded in accordance with American Thoracic Society guidelines (24) Lung function data ... we examined exposure-response relations between the acumulated exposures during followup according to the specific welding technology We also examined decline in lung function according to exposure ... decline in lung function according to our Table 3: Full shift average exposure to welding fume particulates measured in air samples collected among 44 randomly selected welders in 1987 in comparison...
- 8
- 437
- 0
báo cáo hóa học:" Revision of failed hip resurfacing to total hip arthroplasty rapidly relieves pain and improves function in the early post operative period" pdf
Ngày tải lên :
20/06/2014, 04:20
... pain and inability to return to normal activity Figure A comminuted complex intertrochanteric fracture occurring due to the patient falling from his bicycle The acetabular component was retained ... logical to avoid cobalt chrome components in the bearing couple when revising for this indication While it is too early to comment on the clinical outcomes of these prostheses, the main determinants ... occupational work Active Regularly participates in active events such as bicycling, aqua-aerobics Gardening or working out in the gym once or twice a week Very active: Regularly participates in...
- 6
- 305
- 0
báo cáo hóa học:" Revision of failed hip resurfacing to total hip arthroplasty rapidly relieves pain and improves function in the early post operative period" pptx
Ngày tải lên :
20/06/2014, 07:20
... pain and inability to return to normal activity Figure A comminuted complex intertrochanteric fracture occurring due to the patient falling from his bicycle The acetabular component was retained ... logical to avoid cobalt chrome components in the bearing couple when revising for this indication While it is too early to comment on the clinical outcomes of these prostheses, the main determinants ... occupational work Active Regularly participates in active events such as bicycling, aqua-aerobics Gardening or working out in the gym once or twice a week Very active: Regularly participates in...
- 6
- 359
- 0
Báo cáo hóa học: " Two-dimensional downlink burst construction in IEEE 802.16 networks" ppt
Ngày tải lên :
20/06/2014, 22:20
... applied to determine the optimal connection-subchannel match Chen et al [4] proposed the dynamic frequency selection approach, in which each connection selects its subchannel according to the ... function FindMCS(i,j,h) calculates the MCS used by the burst located in the corner j with the height h BCO evaluates the burst constructed in each corner by the NOSCal, MCSCal, and ThCal functions ... optimal corner by virtually constructing the burst in each corner to address the optimal block exploration (line 6-13), i.e., BCO repeatedly invokes the ConstructBurst function to virtually construct...
- 18
- 349
- 0
Báo cáo sinh học: " Research Article Two-Dimensional Harmonic Retrieval in Correlative Noise Based on Genetic Algorithm" pdf
Ngày tải lên :
21/06/2014, 16:20
... for two- dimensional processes,” in Proceedings of the 4th International Conference on Signal Processing (ICSP ’98), pp 43–46, Beijing, China, October 1998 [17] D E Goldberg, Genetic Algorithms in ... fitness function The niche techniques gather the individuals on several peaks of fitness function in the population according to genetic likeness The structure of a niche is implemented by decreasing ... using two- dimensional cyclic statistics,” Journal of Electronics, vol 31, no 10, pp 1522–1525, 2003 (Chinese) [10] S.-Y Yang and H.-W Li, Two- dimensional harmonics parameters estimation using...
- 10
- 260
- 0
Báo cáo hóa học: " In Situ Generation of Two-Dimensional Au–Pt Core–Shell Nanoparticle Assemblies" pptx
Ngày tải lên :
22/06/2014, 00:20
... difference in ionic charges of the respective ions and electrostatic interactions working in the process Water contact angle measurements are used to follow the change in surface character during different ... nanoparticles on ITO surfaces were collected using USB4000-UV-VIS spectrophotometer from Ocean Optics (Dunedin, FL) Surfaces with nanoparticles were directly introduced into the cuvette Nanoscale ... using standard three-electrode configuration, which was controlled by a CHI66 0C electrochemical workstation (CH Instruments, Inc Austin, TX) A coiled platinum wire was used as the counter electrode,...
- 7
- 228
- 0
Báo cáo khoa học: "Contribution of two-dimensional electrophoresis of proteins to maritime pine genetics" ppt
Ngày tải lên :
08/08/2014, 18:21
... with 10% TCA (trichloroacetic acid) and 0.07% 2-mercaptoethanol in acetone Proteins were precipitated for h at -20 C After centrifugation at 15 000 g for 15 min, the protein pellets were rinsed ... maps CONCLUSION Assessing genetic diversity for breeding purposes or in tree to manage species genetic requires a large genome sampling which can be obtained by using the twodimensional electrophoresis ... molecular weight but differing in the isoelectric point These two polypeptides were considered as two products of a single structural gene with codominant inheritance (fig 2) In a F selfed progeny...
- 12
- 400
- 0
Báo cáo khoa học: "Relationship of cognitive function in patients with schizophrenia in remission to disability: a cross-sectional study in an Indian sample" pps
Ngày tải lên :
08/08/2014, 23:20
... contributed to recruiting patients, confirming the diagnosis and interpretation of results References Sharma T, Antonova L: Cognitive function in schizophrenia Deficits, functional consequences, ... Psychological Corporation; 1990 Mukundan CR: NIMHANS neuropsychological battery: test descriptions, instructions, clinical data and interpretation In Proceedings of the National Workshop in Clinical ... evidence to suggest that older patients with schizophrenia (>65) show a progressive decline in cognitive functioning compared to younger patients [30] Symptomatology and functional outcome Previous...
- 8
- 397
- 0
Báo cáo khoa học: "Two years experience with quality assurance protocol for patient related Rapid Arc treatment plan verification using a two dimensional ionization chamber array" docx
Ngày tải lên :
09/08/2014, 09:20
... spinal cord to got higher dose to the spinal cord which could not be clinically tolerated b) Passing rate against the maximum dose to the spinal cord of the same head and neck case Rapid Arc ... lines indicate the in our clinic tolerated limits: 45 Gy maximum dose to the spinal cord and 99% passing rate MatriXX correctly Correctly in this context means that the angular dependence is clinically ... ionization chamber) The manufacturer of the treatment machine specifies dose stability during gantry rotation to 2%; accuracy of gantry, collimator, and couch rotation to 0.75 mm; and accuracy of MLC...
- 8
- 345
- 1
Báo cáo khoa học: " Comparing two strategies of dynamic intensity modulated radiation therapy (dIMRT) with 3-dimensional conformal radiation therapy (3DCRT) in the hypofractionated treatment of high-risk prostate cancer" doc
Ngày tải lên :
09/08/2014, 10:21
... significantly less will need to be defined in current and future clinical trials In Canada, a clinical trial is underway evaluating linac based IMRT and helical tomotherapy, clinically assessing ... Roy C, Bellin MF: Sinerem-enhanced MRI imaging compared to plain MR imaging in evaluating lymph node metastases from urologic and gynaecologic cancers [abstract] Proceedings of the Radiological ... 11 12 13 Canadian Cancer Society/National Cancer Institute of Canada: Canadian Cancer Statistics 2006 Toronto, Canada 2006 Lukka H, Warde P, Pickles T, Morton G, Brundage M, Souhami L, Canadian...
- 10
- 363
- 0
Báo cáo y học: "Systematic mapping of two component response regulators to gene targets in a model sulfate reducing bacterium" ppt
Ngày tải lên :
09/08/2014, 23:20
... flagella regulator DVU1063 is homologous to the flagella regulator FlbD in C crescentus [32], and the binding site motif (GGCAxxxxTGCC) resembles that of the C crescentus FlbD (CCCGGCAxxxxxTGCCGGG) where ... Transcription factor binding sites/ Two component system mapping} Background Signal transduction to sense and respond to environmental and intracellular changes governs key cellular regulatory functions ... plasmid encoded regulator DVUA0057 has been predicted to regulate genes encoding proteins with a PEP-CTERM domain This domain is predicted to target proteins for export into the exopolysaccharide...
- 61
- 401
- 0