outline of a letter of request for information about the admission requirements to a university in england

Tài liệu Information technology — Security techniques — Code of practice for information security management pdf

Ngày tải lên : 21/02/2014, 10:20

... communicating, or managing the organization’s information and information processing facilities Other information Information might be put at risk by external parties with inadequate security management ... Other information There are many types of assets, including: a) information: databases and data files, contracts and agreements, system documentation, research information, user manuals, training ... receive early warnings of alerts, advisories, and patches pertaining to attacks and vulnerabilities; d) gain access to specialist information security advice; e) share and exchange information about...

130
1K
0

Tài liệu Báo cáo khoa học: "REPRESENTATION OF TEXTS FOR INFORMATION RETRIEVAL" pdf

Ngày tải lên : 21/02/2014, 20:20

... ~ a r e d to the evaluations of the original analysis and to one another From the comparisons can be determined: the extent to which discourse theory can be translated into these terms; and the ... text, yet are unlikely to be used often in the abstract Hyphenate phrases in the input text (phrases chosen algorithmically) and then either: a Use the phrase only as a unit equivalent to a single ... structure into rough equivalents within the word-cooccurrence paradigm We choose this strategy, rather than attempting a complete and theoretically adequate discourse analysis, in order to incorporate...

2
419
0

An Outline of Strategies for Building an Innovation System for Knowledge City pptx

Ngày tải lên : 06/03/2014, 20:21

... other areas For example, in our case studies, Silicon Valley has the natural advantage of the mild weather of Northern California, and Maryland is home to the National Institutes of Health The ... creation of an innovation-based cluster These attributes fall into three broad categories The first encompasses the natural advantages of an area Such advantages are innate and cannot be replicated ... area where the industry began The original site of an industry creates a first-mover advantage Although this advantage may be due to historical accident, having attractive assets increases the...

100
399
1

Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

Ngày tải lên : 16/03/2014, 04:20

... The assay was performed at mm carnitine as standard To analyze PigE17DCPT1B and HumanD17ECPT1B mutants, the assay was performed at carnitine concentrations equal to the Km The percentage of activity ... pGEMT–5¢HumanCPT1B as a template in a PCR reaction with primers DH673 (5¢-AGCTGAATTC ATGGCGGAAGCTCACCAG-3¢) and DH803 (5¢-TCCA CCCATGGTAGCAGAGAAGCAGCTTAAGGGTTTGG CGGA-3¢) The PCR reaction yielded a 422-bp ... was used as a template to introduce a mutation using the QuickChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) The primers were DH869 (5¢-GGAGTTGCTGGCC AAAGAGTTCCAGGACAAGACTGCCC-3¢)...

9
550
0

Information technology — Security techniques — Code of practice for information security management pot

Ngày tải lên : 17/03/2014, 13:20

... communicating, or managing the organization’s information and information processing facilities Other information Information might be put at risk by external parties with inadequate security management ... Other information There are many types of assets, including: a) information: databases and data files, contracts and agreements, system documentation, research information, user manuals, training ... involves the person having access to information processing facilities, and in particular if these are handling sensitive information, e.g financial information or highly confidential information, ...

130
588
0

Information technology — Code of practice for information security managemen

Ngày tải lên : 13/09/2016, 14:27

... person having access to information processing facilities, and in particular if these are handling sensitive information, e.g financial information or highly confidential information, the organization ... changes in the exposure of information assets to major threats; c) reviewing and monitoring information security incidents; d) approving major initiatives to enhance information security One manager ... located or where trade is taking place There should be a formal authorization process before information is made publicly available Software, data and other information requiring a high level of...

84
343
0

An exploratory study on the teaching and learning of TOEIC listening skill at a university in Hanoi = Nghiên cứu khảo sát việc dạy và học kỹ năng nghe TOEIC tại

Ngày tải lên : 28/03/2015, 09:16

... time available; the material available; the ability of the class; the interests of the class; the interests of the teacher; the place in which the work is being carried out; the nature and content ... socially oriented talk while the aim of a transactional dialogue is obtaining and providing information A further distinction is made between familiar and unfamiliar interpersonal dialogues on the ... lecture, a radio ad) and the function of the message (to persuade/inform /request) ; (4) predicting information expected to be included in the message; (5) recalling background information to help interpret...

62
821
1

AN INVESTIGATION INTO THE EFFECTIVENESS OF COLLABORATIVE BRAINSTORMING AT THE PRE WRITING STAGE IN INTERMEDIATE ENGLISH CLASSES AT a UNIVERSITY IN HANOI

Ngày tải lên : 14/09/2015, 09:23

... group brainstorming: altering individual and group brainstorming sessions, writing ideas rather than talking (brainwriting), using computers to brainstorm (electronic brainstorming), training for ... Participants are divided into groups of individual brainstormers and collaborative brainstormers Then they participate in either training or no-training on idea generation sessions In the study, the participants ... collaborative brainstorming, and investigated influences of collaborative brainstorming on the ideas expressed in their writing The training sessions and the techniques were applied in writing letters...

108
314
0

Experimental Research on the Effect of Self-monitoring Technique on Improving Writing Skill among English-major Freshmen at a University in Hanoi

Ngày tải lên : 11/01/2017, 21:41

... applications towards upgrading the learning and teaching writing for English-major freshmen at this university as well as at other universities Aims and objectives The research aims at investigating the ... being asked to produce in- class texts It is actually hard for them to produce a high quality text due to such reasons as language incompetence, lack of motivation and a traditionally passive way ... degree of Master of Arts (TEFL) accept the requirements of the university relating to the retention and use of Master Thesis deposited in the library In terms of these conditions, I agree that the...

11
413
0

DSpace at VNU: Impact of Imperfect Channel Information on the Performance of Underlay Cognitive DF Multi-hop Systems

Ngày tải lên : 16/12/2017, 15:45

... Both simulation and analysis are in perfect agreement, validating the accuracy of (3) Additionally as expected in the analysis of Sect 3.1, PI decreases with the decrease of ρ Nevertheless, this ... 209–219 Caijun, Z., Ratnarajah, T., & Kai-Kit, W (2011) Outage analysis of decode-and-forward cognitive dualhop systems with the interference constraint in Nakagami-m fading channels IEEE Transactions ... amplify-and-forward (AF) have been extensively investigated [5] In DF, each relay decodes information from the source, re-encodes it, and then forwards it to the destination In AF, each relay simply amplifies...

12
125
0

The NINCH Guide to Good Practice in the Digital Representation and Management of Cultural Heritage Materials pptx

Ngày tải lên : 08/03/2014, 14:20

... in the analog material • Metadata/Cataloging: The creation of metadata records for the digital material This work may also involve cataloging the analog material or searching for information to ... required for the metadata record of the digital object can be generated automatically: for instance, automatic metadata creation is a feature of much high-end digital camera software and of some ... sense of the plethora of materials coming out on information and technical standards, metadata, imaging, project management, digital asset management, sustainability, preservation strategies, and...

242
579
0

the impact of corporate social responsibility about the environment issue of vietnamese limited companies

Ngày tải lên : 13/03/2014, 14:20

... forces behind embracing CSR is to follow the national mission statement, tmanagers mention the satisfactory of the general expectation of the community, to maintain the balance for all sustainable ... economy into socialistoriented market economy which lead to a change in the way of operation to promote the ability of each individual and creating motivation to develop the economy to increase the ... needed information may not available It is very difficult for researcher to get all information they need in secondary data or when the data is available it may usefulness 3.5 Research method - For...

67
558
0

Báo cáo Y học: A new conceptual framework for enzyme catalysis Hydrogen tunneling coupled to enzyme dynamics in ﬂavoprotein and quinoprotein enzymes docx

Ngày tải lên : 31/03/2014, 23:20

... 2B) The partial charges of the iminoquinone were calculated using SPARTAN (Wavefunction Inc., Irvine, CA, USA); the entire protein (including iminoquinone) was then protonated and solvated, and ... relative rates of C–H and C–D bond breakage in dopamine, tryptamine and benzylamine, and the relative KIEs, give important insight into the shape of the potential energy barrier separating reactants ... in a H172Q mutant TMADH [44], and by an additional factor of in a Y169F mutant TMADH [43] Both His172 and Tyr169 are located near the substrate-binding site and the ﬂavin isoalloxazine ring as...

7
359
0

Báo cáo sinh học: " Reduced expression of Jak-1 and Tyk-2 proteins leads to interferon resistance in Hepatitis C virus " docx

Ngày tải lên : 18/06/2014, 18:20

... IFN-α binds the receptor Interferon binding to the cell surface receptors activates the intracellular signaling pathways, which involve Janus kinase (JAK1), tyrosine kinase (TYK2) and signal transducer ... to the differences in the amount of proteins loaded into the gel since beta-actin levels are found to be similar Discussion Interferon alpha in combination with ribavirin is the standard treatment ... minutes at room temperature Blocking for endogenous biotin-avidin was performed using a commercially available kit (Avidin/Biotin Blocking Kit, Vector Laboratories Inc., Burlingame, CA) Blocking...

13
305
0

O''''Reilly Network For Information About''''s Book part 1 ppt

Ngày tải lên : 07/07/2014, 08:20

... short, the community and breadth of Java have always trumped anything that the alternatives have to offer So I quit looking And I'm glad that I did, because it allowed me to focus on building a consulting ... ignoring alternatives works in your favor Figure 1-1 shows what I mean When a new language arrives with the power and dominance of a Java or C++, you can afford to ignore alternatives for a while ... need for writing, and gives me a reason to be We share a common purpose in raising our daughters, Kayla and Julia, a common foundation of faith in Jesus Christ, an unending hospitality for weary...

6
314
0

O''''Reilly Network For Information About''''s Book part 2 docx

Ngày tải lên : 07/07/2014, 08:20

... mean that code needs to be happening at a higher level of abstraction, and we've been incapable of finding it in Java 1.2.2.3 Unnatural stretching Increasingly, you're probably stretching Java ... 1.2.2.4 Language evolution Java is strongly touted as perhaps the most innovative major release of Java in half a decade I agree that it's going to have a significant impact I'm not at all convinced ... have a very practical way of evaluating what is the hot technology: [determining] what earns you the most money being a trainer of that technology Java definitely was the hot technology for years...

8
351
0

O''''Reilly Network For Information About''''s Book part 3 pot

Ngày tải lên : 07/07/2014, 08:20

... in Smalltalk, and most of it centers around a framework called Seaside Since continuations maintain state, continuation-based servers don't have any problem managing state They also handle Back ... buttons and threading with relative ease This framework uses a language feature called continuations to maintain state within a web-based application 1.4 The Premise I don't mean to say that Smalltalk ... frameworks necessary to make the architecture go Many customers became increasingly wary of a gathering Microsoft monopoly The tools of the day made it easy to get started, but did not handle complexity...

8
294
0

O''''Reilly Network For Information About''''s Book part 4 potx

Ngày tải lên : 07/07/2014, 08:20

... conditions The primary success in the initial Java explosion was based on the extraordinary migration of the C++ community To this, Java had to walk a tightrope with excellent balance C++ had some ... any kind of dependency checking As many applications share versions of the same programming libraries, it was possible, and even probable, that installing your application might replace a library ... including Java Beginning in 1997, the ANSI standard for C++ introduced a more formal string You could have a more natural representation that looked like this: String str = "Hello, I'm feeling a...

6
270
0