notifications issued in compliance with article 86 of the revised companies act to investees in which the company obtains a direct or indirect interest of more than 10

Báo cáo khoa học: "Serous adenocarcinoma of the fallopian tube, associated with verrocous carcinoma of the uterine cervix: a case report of synchronic rare gynecological tumors" pps

Báo cáo khoa học: "Serous adenocarcinoma of the fallopian tube, associated with verrocous carcinoma of the uterine cervix: a case report of synchronic rare gynecological tumors" pps

Ngày tải lên : 09/08/2014, 04:21
... cervical carcinoma and IA G3 fallopian tube carcinoma according to FIGO staging system The patient declined any adjuvant treatments, either chemotherapy or radiotherapy or both The patient remained ... 2–3 years, and are nearly all extrapelvic [10, 11] Initial treatment is surgical as in ovarian carcinoma Adjuvant treatment with chemotherapy is with platinum- and taxane-based schemes, obtaining ... one of them [14] was associated with two other tumors of the genital tract (endometrial and ovarian), the characteristic of this case is that both tubal and cervical carcinoma were from glandular...
  • 5
  • 384
  • 0
Báo cáo khoa học: Identification of critical residues of subunit H in its interaction with subunit E of the A-ATP synthase from Methanocaldococcus jannaschii potx

Báo cáo khoa học: Identification of critical residues of subunit H in its interaction with subunit E of the A-ATP synthase from Methanocaldococcus jannaschii potx

Ngày tải lên : 30/03/2014, 04:20
... E101–206), the primers 5¢-GTTGCCA TGGCTGTGAAATTGATGGGA-3¢ (forward), 5¢-CTCCG AGCTCTCATGGCAGTTTAAC-3¢ (reverse) and 5¢-ATA CCATGGAACAGCCAGAGTATAAAG-3¢ (forward), 5¢AGGGAGCTCTCAGAATAACTTCTCTGTA-3¢ (reverse), ... M jannaschii is composed of 206 amino acids, divided into a predicted a- helix at the N-terminal part (amino acids 1 100 ) and an a- helical and b-sheet-containing domain at the C-terminal part ... comparison with an increase of the diffusion time The increase of the diffusion time is caused by the increment of the size of the particles because of the interaction of E41–60 with H1–47 according to...
  • 10
  • 351
  • 0
Báo cáo hóa học: " Research Article Analysis of the Tradeoff between Delay and Source Rate in Multiuser Wireless Systems" docx

Báo cáo hóa học: " Research Article Analysis of the Tradeoff between Delay and Source Rate in Multiuser Wireless Systems" docx

Ngày tải lên : 21/06/2014, 11:20
... calculation of the maximum attainable rates in the case of Best Channel strategy leads to the computation of the variance of the blocks (the evaluation of the mean of the blocks is straightforward), which ... the evaluation of the users’ rates for a PF discipline and with the same parameters defined before In the uncorrelated channel, the algorithm was able to equal the users in terms of minimum target ... same as in the uncorrelated channel The in uence of the parameter ρ is remarkable: as expected, the correlation is harmful to the delay performance, so that when the correlation increases (ρ increases),...
  • 13
  • 530
  • 0
báo cáo hóa học:" Research Article Generalizations of the Nash Equilibrium Theorem in the KKM Theory" potx

báo cáo hóa học:" Research Article Generalizations of the Nash Equilibrium Theorem in the KKM Theory" potx

Ngày tải lên : 21/06/2014, 18:20
... Point Theory and Applications 10 to in nite families and applied it to an analytic formulation of Fan type and to the Nash theorem for arbitrary families Note that all of the above results are ... abstract convex spaces The partial KKM principle for an abstract convex space is an abstract form of the classical KKM theorem A KKM space is an abstract convex space satisfying the partial KKM ... Himmelberg theorem to multimaps factorizable by Kakutani maps through convex sets in Hausdorff topological vector spaces Moreover, Lassonde applied his theorem to game theory and obtained a von Neumann-type...
  • 23
  • 323
  • 0
báo cáo hóa học:" Research Article Analysis of the Effects of Finite Precision in Neural Network-Based Sound Classifiers for Digital Hearing Aids" pot

báo cáo hóa học:" Research Article Analysis of the Effects of Finite Precision in Neural Network-Based Sound Classifiers for Digital Hearing Aids" pot

Ngày tải lên : 21/06/2014, 20:20
... the scale factor 2b , aiming at determining which are the bits of x that lead to the best approximation of function f (3) The b parameter in the aforementioned scale factor determines the way fT256 ... hearing aids have constraints in terms of computational capability and memory The hearing aid has to work at low clock rates in order to minimize the power consumption and thus maximize the battery ... for each set The training set is used to determine the weights of the MLP in the training process, the validation set helps evaluate progress during training and to determine when to stop training,...
  • 12
  • 414
  • 0
Báo cáo hóa học: " Research Article State of the Art: Embedding Security in Vehicles" pot

Báo cáo hóa học: " Research Article State of the Art: Embedding Security in Vehicles" pot

Ngày tải lên : 22/06/2014, 19:20
... Challenge-response protocol characteristic automotive technical and organizational constraints 3.1 Attackers in the automotive area Today attackers within the automotive area usually either want ... either manually by vehicle occupants or automatically via activation of in- vehicle sensors At the same time, actual location, available incident, or medical data will be sent to the eCall operator ... cost-efficiently with most features already built -in, but individually activated Moreover, it is possible to individually activate (or deactivate) builtin hardware components or software after sales for an additional...
  • 16
  • 287
  • 0
Báo cáo hóa học: " Research Article Decorrelation of the True and Estimated Classifier Errors in High-Dimensional Settings" docx

Báo cáo hóa học: " Research Article Decorrelation of the True and Estimated Classifier Errors in High-Dimensional Settings" docx

Ngày tải lên : 22/06/2014, 19:20
... Str and test set Sts are generated For the synthetic data, n examples are created for the training set and 100 00 examples for the test set For the microarray data, the examples are separated into ... of 295 or 203, the amount of overlap between the training sets is small The average size of the overlap is about examples for the breastcancer data sets and 12 examples for the lung-cancer data ... measures the dependence between two variables It is used to estimate the information that a feature contains to predict the class A high value of mutual information means that the feature contains a...
  • 12
  • 306
  • 0
Báo cáo khoa học: "Effect of β -mercaptoethanol or epidermal growth factor supplementation on in vitro maturation of canine oocytes collected from dogs with different stages of the estrus cycle" ppsx

Báo cáo khoa học: "Effect of β -mercaptoethanol or epidermal growth factor supplementation on in vitro maturation of canine oocytes collected from dogs with different stages of the estrus cycle" ppsx

Ngày tải lên : 07/08/2014, 18:20
... and transported back to the laboratory within h Ovaries were removed from the tract and washed free from blood in fresh PSS, and then repeatedly slashed with a #10 scalpel blade or shaving blade ... for GSH, including increasing amino acid transport, stimulating DNA and protein synthesis, reduction of disulfides and protection against toxic effects of oxidative damage [21] Takahashi et al ... paracrine and autocrine regulator of ovarian function [3,12] The EGF is one of many growth factors found throughout the body, including growing antral follicles within the ovary, and has shown to stimulate...
  • 6
  • 250
  • 0
Báo cáo khoa học: "Retroperitoneal abscess complicated with necrotizing fasciitis of the thigh in a patient with sigmoid colon cancer" ppt

Báo cáo khoa học: "Retroperitoneal abscess complicated with necrotizing fasciitis of the thigh in a patient with sigmoid colon cancer" ppt

Ngày tải lên : 09/08/2014, 04:21
... abscess and emergent CT guided drainage of the abscess was performed A pigtail catheter was inserted into the abscess and pus with gas and odor was drained; an infection caused by gas-producing anaerobic ... retroperitoneal inflammation On the basis of the operative findings, the tumor was classified as a T4 (invading the psoas muscle), N1, and M1 (liver and peritoneum), and the patient was clinically diagnosed ... benefits are necessary before performing a palliative surgery Figure left thigh Abnormal air accumulation in the subcutaneous space of the Abnormal air accumulation in the subcutaneous space of the...
  • 4
  • 316
  • 0
Báo cáo y học: "Expression of bioactive bone morphogenetic proteins in the subacromial bursa of patients with chronic degeneration of the rotator cuff" pptx

Báo cáo y học: "Expression of bioactive bone morphogenetic proteins in the subacromial bursa of patients with chronic degeneration of the rotator cuff" pptx

Ngày tải lên : 09/08/2014, 08:22
... TTTGGGGCCAAGTTTTTCTG down BMP-2 up ACAGGAACTTCCGGGTCAAT up GGGAAAACAACCCGGAGATT down TTAAGGCGTTTCCGCTGTTT FGF-2 up TACAACTTCAAGCAGAAGAG down CAGCTCTTAGCAGACATTGG VEGF up AAGTGGTCCCAGGCTGCA down ATCTCTCCTATGTGCTGGCC ... tissue – the ratio of FGF-2 mRNA to GAPDH mRNA was about 10 times lower than the ratio of BMP mRNA to GAPDH mRNA- and was not preferentially localized within the bursa Of the family of inflammatory ... ATCTCTCCTATGTGCTGGCC up AAGCAGCCATGGCAGAAGTA 482 60 37 [NCBI: M15840] down GAACACCACTTGTTGCTCCA up GAGTGACAAGCCTGTAGCCCATGTTGTAGCA 444 60 37 Clontech down GCAATGATCCCAAAGTAGACCTGCCCAGACT IL-1 TNF- The...
  • 9
  • 412
  • 0
Báo cáo y học: "Association of a single nucleotide polymorphism in growth differentiate factor 5 with congenital dysplasia of the hip: a case-control study" ppt

Báo cáo y học: "Association of a single nucleotide polymorphism in growth differentiate factor 5 with congenital dysplasia of the hip: a case-control study" ppt

Ngày tải lên : 09/08/2014, 13:22
... taking a detailed history and physical examination The severity of CDH was defined from mild instability of the femoral head with slight capsular laxity, to moderate lateral displacement of the ... the femoral head, without loss of contact of the head with the acetabulum, and then to complete dislocation of the femoral head from the acetabulum [22] Cases were scored according to the severity ... Genet A 2003, 11 7A: 136-142 20 Miyamoto Y, Mabuchi A, Shi D, Kubo T, Takatori Y, Saito S, Fujioka M, Sudo A, Uchida A, Yamamoto S, Ozaki K, Takigawa M, Tanaka T, Nakamura Y, Jiang Q, Ikegawa S: A...
  • 5
  • 443
  • 0
Báo cáo y học: "Methotrexate therapy associates with reduced prevalence of the metabolic syndrome in rheumatoid arthritis patients over the age of 60- more than just an anti-inflammatory effect? A cross sectional study" pptx

Báo cáo y học: "Methotrexate therapy associates with reduced prevalence of the metabolic syndrome in rheumatoid arthritis patients over the age of 60- more than just an anti-inflammatory effect? A cross sectional study" pptx

Ngày tải lên : 09/08/2014, 14:22
... thus again arguing against a potential anti-inflammatory mechanism of action of methotrexate In view of patient age acting as an independent predictor for the MetS, we performed a further subanalysis ... Patient data was obtained via case note analysis and a faceto-face interview performed by a rheumatologist The dual approach facilitated the documentation of a detailed history to include: disease ... insulin resistance Metabolism 1988, 37:125-130 Zonana-Nacach A, Santana-Sahagun E, Jimenez-Balderas FJ, Camargo-Coronel A: Prevalence and factors associated with metabolic syndrome in patients with...
  • 10
  • 499
  • 0
Báo cáo y học: "Double chambered right ventricle with severe calcification of the tricuspid valve in an elderly woman: a case report" ppsx

Báo cáo y học: "Double chambered right ventricle with severe calcification of the tricuspid valve in an elderly woman: a case report" ppsx

Ngày tải lên : 10/08/2014, 23:21
... Radiology who assisted in the performance of clinical examinations and the collection our patient’s data Authors’ contributions NT contributed to the management of the patient, and was a major ... 50(1):19-29 Tamai et al Journal of Medical Case Reports 2011, 5: 210 http://www.jmedicalcasereports.com/content/5/1/ 210 Page of Nagashima M, Tomino T, Satoh H, Nakata T, Ohtani T, Saito H: Doublechambered ... on the literature review All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests Received: July 2 010 Accepted: 27 May...
  • 4
  • 332
  • 0
Báo cáo khoa hoc:" Papillary carcinoma arising in a thyroglossal duct cyst with associated microcarcinoma of the thyroid and without cervical lymph node metastasis: a case report" pot

Báo cáo khoa hoc:" Papillary carcinoma arising in a thyroglossal duct cyst with associated microcarcinoma of the thyroid and without cervical lymph node metastasis: a case report" pot

Ngày tải lên : 11/08/2014, 10:23
... JM, Morera C: Papillary thyroid cacinoma arising in the wall of a thyroglossal duct cyst Acta Otorhinolaryngol Belg 1998, 52:49-54 Yang YJ, Wanamaker JR, Powers CN: Diagnosis of papillary carcinoma ... consisting of excision of the thyroglossal duct cyst, the central portion of the body of the hyoid bone, and a core of tissue around the thyroglossal tract to open into the oral cavity at the foramen ... cyst, and squamous cell carcinoma arising from metaplastic columnar cells that line the duct [1] More then 200 cases of thyroglossal duct carcinomas have been reported in which papillary carcinoma...
  • 3
  • 311
  • 0
Báo cáo y học: " Magnetic resonance imaging with pathological correlation in a case of mantle cell lymphoma of the parotid gland: a case report" ppsx

Báo cáo y học: " Magnetic resonance imaging with pathological correlation in a case of mantle cell lymphoma of the parotid gland: a case report" ppsx

Ngày tải lên : 11/08/2014, 12:20
... parotid tumors, especially Warthin tumors and adenoid cystic carcinomas, which may also have a solid cystic appearance These tumors rarely occupy the total gland parenchyma In particular, Warthin ... cell Author details Department of Radiology, General Hospital G Papanikolaou, Thessaloniki, Greece 2Department of Haematology, General Hospital G Papanikolaou, Thessaloniki, Greece 3Laboratory of ... Adenoid cystic carcinoma usually presents as an infiltrating mass with a high propensity for perineural invasion On MRI adenoid cystic carcinoma has an irregular contour, poorly defined margins,...
  • 5
  • 399
  • 0
Báo cáo y học: " Simultaneous monteggia type I fracture equivalent with ipsilateral fracture of the distal radius and ulna in a child: a case report" docx

Báo cáo y học: " Simultaneous monteggia type I fracture equivalent with ipsilateral fracture of the distal radius and ulna in a child: a case report" docx

Ngày tải lên : 11/08/2014, 21:22
... angulation of the fracture with anterior dislocation of the radial head; the second most common is fracture of the proximal third of the ulna, lateral angulation of the fracture and lateral dislocation ... dislocation of the radial head; proximal ulna fracture with post-dislocation of the radial head; fracture of the proximal radius and ulna with dislocation of the radial head Three Monteggia equivalent ... separation of the distal radial physis [4]; type IV Monteggia injury with distal diaphyseal fracture of the radius [5]; 11 cases of Monteggia fracture dislocation with fracture of the ipsilateral...
  • 4
  • 338
  • 0
Báo cáo y học: " Efficacy and safety of an antiviral Iota-Carrageenan nasal spray: a randomized, double-blind, placebo-controlled exploratory study in volunteers with early symptoms of the common cold" doc

Báo cáo y học: " Efficacy and safety of an antiviral Iota-Carrageenan nasal spray: a randomized, double-blind, placebo-controlled exploratory study in volunteers with early symptoms of the common cold" doc

Ngày tải lên : 12/08/2014, 11:22
... onset of symptoms Iota-Carrageenan nasal spray is formulated as a solution of Iota-Carrageenan and NaCl in water intended for direct intranasal application Tests for effectiveness of blinding of the ... special actions were necessary The small number of AE reports supports in particular the good safety-profile of Iota-Carrageenan as an active agent and Iota-Carrageenan nasal spray components in ... AGR, EPG, MJA, REC participated in the design, statistical analyses and coordination of the study, interpretation of data and writing the manuscript All authors read and approved the final manuscript...
  • 10
  • 473
  • 0
Báo cáo y học: "Association of the D repeat polymorphism in the ASPN gene with developmental dysplasia of the hip: a case-control study in Han Chinese" potx

Báo cáo y học: "Association of the D repeat polymorphism in the ASPN gene with developmental dysplasia of the hip: a case-control study in Han Chinese" potx

Ngày tải lên : 12/08/2014, 15:22
... Shirokanedai, Minato-ku, Tokyo 108 -863 9, Japan Authors’ contributions All authors contributed to the final manuscript In addition, DS and JD genotyped the samples and participated in the design and analysis ... Xuefu Road 12, Nanjing 2100 08, Jiangsu, PR China 3Center of Diagnosis and Treatment for Congenital Dysplasia of Hip, Kang’ai Hospital, Nanchang Road 32, Nanjing 2100 08, Jiangsu, PR China 4Department ... Congenital dislocation of the hip in identical twins J Bone Joint Surg Br 1959, 41:314-318 11 Mabuchi A, Nakamura S, Takatori Y, Ikegawa S: Familial osteoarthritis of the hip joint associated with acetabular...
  • 5
  • 273
  • 0
Sanitation in Urban Poor Settlement and the Importance of Education for the Reduction of the Diffused Pollution - A Case Study of Bauniabad, Bangladesh

Sanitation in Urban Poor Settlement and the Importance of Education for the Reduction of the Diffused Pollution - A Case Study of Bauniabad, Bangladesh

Ngày tải lên : 05/09/2013, 09:08
... currently there are more than 7000 families due to normal family growth and to some families renting a part of their houses to other families History of a series of efforts in Bauniabad One of the authors ... latrines and hand pumps which were installed at the beginning of the establishment of Bauniabad area The main activities included; (i) a baseline and needs assessment survey, (ii) training of ... know the benefit of having the connection of their latrines to biogas plants At the installation, the community agreed to share the 20% of the installation cost and the 100 % of cleaning cost of...
  • 9
  • 971
  • 0