modern method for guitar 3 pdf
Tài liệu English for Business (Lesson 3) pdf
Ngày tải lên :
12/12/2013, 22:15
... tôi sau khi ông ấy nói
chuyện xong được không? Chuyện này hơi gấp cô ạ.
Lesson 3: Over the phone
Bài 3: Nói chuyện qua điện thoại
Trần Hạnh và toàn Ban Tiếng Việt Đài Úc Châu xin thân ... ta thường hỏi để nói chuyện với ai đó trên điện thoại.
Một cách hỏi khác là:
“Is it possible for me to speak to Harvey, please?”
Cho tôi nói chuyện với Harvey được không ạ?
Cũng có khi người ... thử tập nói những câu mở đầu sau đây:
English:
Could I speak to John, please?
Is it possible for me to speak to John, please?
I‟m after John Brown? Is he in?
Làm ơn cho tôi nói chuyện với...
- 10
- 1.1K
- 4
Tài liệu Bullentin for toefl part 3 pdf
Ngày tải lên :
13/12/2013, 22:15
... Kuwait
32 3 Kyrgyzstan
32 5 Lao, People’s
Democratic
Republic
32 8 Latvia
33 0 Lebanon
33 3 Lesotho
33 5 Liberia
34 0 Libyan Arab
Jamahiriya
34 3 Liechtenstein
34 4 Lithuania
34 5 Luxembourg
34 7 Macau
34 8 ... Japanese
33 2 Javanese
33 5 Kannada
121 Kanuri
33 8 Kashmiri
33 9 Kazakh
31 0 Khmer
142 Kikuyu
1 23 Kinyarwanda
35 2 Konkani
34 0 Korean
34 2 Kurdish
35 9 Kurukh
604 Kusaiean
34 3 Lao
452 Latvian
145 Lingala
4 53 ... Georgian
437 German
440 Greek
201 Guarani
32 0 Gujarati
266 Gwichin
133 Hausa
507 Hebrew
31 9 Hiligaynon
32 3 Hindi
4 43 Hungarian
136 Igbo
447 Icelandic
32 6 lloko
32 8 Indonesian
269 Inupiaq
450 Italian
33 1...
- 10
- 572
- 0
Tài liệu KRONE HIGHBANDTM Arrestor Magazine 3 Pole Equipped Overvoltage Protection for HIGHBAND 10 pdf
Ngày tải lên :
21/12/2013, 18:15
... KRONE HIGHBAND
TM
Arrestor Magazine 3 Pole Equipped
Overvoltage Protection for HIGHBAND 10
...
- 2
- 266
- 0
Tài liệu Bulding skill for the toefl ibt transcripts part 3 pdf
Ngày tải lên :
24/12/2013, 02:16
... it. The truth was,
no one back then really knew for sure.
Well, nowadays, we know the truth. Modern geologists know
for sure the Causeway was formed by volcanic activity. They
compare the Causeway’s ... giant. The speaker explains that nobody
knew for sure how it was formed until modern geologists provided
the real answer. Geologists explain that it was formed by volcanic
activity in much the same ... be
caught. The woman agrees and adds that any information should be
reported. They both agree that adding security guards on campus is
a good idea.
Q3 practice 3
M: Have you ever taken a creative writing...
- 10
- 685
- 2
Tài liệu Instructor Notes Module 3: Using a Conceptual Design for Data Requirements pdf
Ngày tải lên :
17/01/2014, 09:20
... Notes Module 3: Using a
Conceptual Design for Data
Requirements
Introduction
This module provides students with a systematic method for beginning the
design process by gathering information ... PowerPoint
®
file P 03_ 1609a.ppt
!
Module 3, “Using a Conceptual Design for Data Requirements”
!
Activity 3. 1, “Identifying Data-Related Use Cases and Data Requirements”
!
Activity 3. 2, “Relating ... prepare for this module, you should:
!
Read all materials for this module.
!
Complete the activities.
!
Refer to Course 1585, Gathering and Analyzing Business Requirements, for
further information...
- 4
- 447
- 0
Tài liệu Dividend Stocks For Dummies Part 3 pdf
Ngày tải lên :
21/01/2014, 23:20
... Consider
Yield as of
12 /31 /09
Name Ticker Symbol Annual Dividend
5.8% BP plc BP $3. 36
5.8% Royal Dutch Shell RDS-B $3. 36
5.0% Total TOT $3. 23
4.2% Eni Spa E $2.14
3. 9% ConocoPhillips COP $2.00
3. 7% Repsol ... that typically accompany those roles. True
19_466018-ch 13. indd 1 831 9_466018-ch 13. indd 1 83 3/24/10 8 :36 PM3/24/10 8 :36 PM
187
Chapter 13: Exploring REITs and Financials
Mortgage REITs
Mortgage ...
Symbol
Annual
Dividend
3. 3% Golden Enterprises GLDC $0. 13
3 .3% VF VFC $2.40
3. 3% The Hershey Co HSY $1.19
3. 0% PepsiCo PEP $1.80
3. 0% Tasty Baking TSTY $0.20
2.9% Procter & Gamble PG $1.76
2.8%...
- 62
- 383
- 1
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
Ngày tải lên :
18/02/2014, 13:20
... Invest 74, 37 4 38 3.
33 Jarrett JT, Berger EP & Lansbury PT Jr (19 93) The car-
boxy terminus of the beta amyloid protein is critical for
the seeding of amyloid formation: implications for the
pathogenesis ... acid
Expected
composition
Observed
composition
Asp + Asn 4 3. 9917
Ser 2 2.1648
Glu + Gln 4 4.06 43
Gly 6 6.0117
Ala 3 3.0265
Val 5 5.08 13
Met 2 1.7661
Ile
a
2 1.1517
Leu 2 1.9 935
Tyr 1 0.96174
Phe 3 2.9287
His 3 2.8426
Lys 2 2.0270
Arg ... concentrations [33 ,38 ,39 ], thus high-level
expression of Ab peptides should lead to aggregation
and formation of inclusion bodies, and that Ab would
be less susceptible to degradation in this form. More-
over,...
- 16
- 691
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
Ngày tải lên :
18/02/2014, 17:20
... 5¢-CTC
GAGATGGATAAAGTTTTAAACAGAG -3 and LTA-
1R, 5¢-TGAAGGCAAATCTCTGGAC -3 for the former,
and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG -3
and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA
GGGG -3 for the latter. The PCR ... for at least 5 days after transfection under drug-selection pressure. Bars = 200 lm. All cells were cultured at 33 °C, and day 40–50 ECs
were used for experiments shown in B–E.
A new method for ... cultured in EBM-2 basal medium with
0.5% serum for 24 h. Cells were incubated with growth
factors at 33 ° C for 10 min and harvested for analysis.
Tube formation of tsA58T-expressing endothelial
cells...
- 11
- 873
- 0
Tài liệu Báo cáo khoa học: "A New Dataset and Method for Automatically Grading ESOL Texts" pdf
Ngày tải lên :
20/02/2014, 04:20
... Spearman’s
feature correlation correlation
none 0.741 0.7 73
word ngrams 0.7 13 0.762
PoS ngrams 0.724 0. 737
script length 0. 734 0.772
PS rules 0.712 0. 731
complexity 0. 738 0.760
ukWaC+CLC LM 0.714 0.712
Table 2: ... contribution to overall performance
is investigated.
3. 1 Rank preference model
SVMs have been extensively used for learning clas-
sification, regression and ranking functions. In its
basic form, a binary ... of the Association for Computational Linguistics, pages 180–189,
Portland, Oregon, June 19-24, 2011.
c
2011 Association for Computational Linguistics
A New Dataset and Method for Automatically...
- 10
- 538
- 0
Tài liệu Báo cáo khoa học: "An Ensemble Method for Selection of High Quality Parses" pdf
Ngày tải lên :
20/02/2014, 12:20
... Adaptation
k value 95 97 100 95 97 100
Coll. MR 3. 5 20.1 29.2 22.8 29.8 33 .6
Coll. CB 11.6 11.7 3. 4 14.2 9.9 7.4
Char. MR 1 .35 13. 6 23. 44 21.9 30 32 .5
Char. CB 21.9 16.8 11.9 25 20.2 16.2
Table ... 95 97 100 95 97 100
Coll. ML 32 .6 37 .2 60.8 46.8 52.7 70.7
Coll. CB 26.5 31 .4 53. 9 46.9 53. 6 70
Char. ML 25.1 33 .2 58.5 46.9 58.4 77.1
Char. CB 20.4 30 52 44.4 55.5 73. 5
Table 2: Error reduction ... over the baselines for this
type of sentences (in the ranges 13 − 46% for the
filter f-score with k = 100, and 30 − 60% for the
average f-score).
As Table 3 shows, on a WSJ sec 23 test set similar
to...
- 8
- 462
- 0
Tài liệu JasperReports 3.5 for Java Developers pdf
Ngày tải lên :
21/02/2014, 05:20
... JasperReports with Spring 32 7
Integrating JasperReports with JSF 33 3
Integrating JasperReports with Struts 33 8
Summary 34 3
Index 34 5
This material is copyright and is licensed for the sole use by William ... Atlanta, , 30 327
www.it-ebooks.info
Table of Contents
[ v ]
Handling very large reports 239
Summary 241
Chapter 9: Exporting to Other Formats 2 43
Exporting overview 244
Exporting to PDF 245
Exporting ... is copyright and is licensed for the sole use by William Anderson on 26th August 2009
431 0 E Conway Dr. NW, , Atlanta, , 30 327
www.it-ebooks.info
JasperReports 3. 5 for Java Developers
Copyright...
- 367
- 1.6K
- 0
Tài liệu Báo cáo khoa học: "A Tool for Multi-Word Expression Extraction in Modern Greek Using Syntactic Parsing" pdf
Ngày tải lên :
22/02/2014, 02:20
... Demonstrations Session, pages 45–48,
Athens, Greece, 3 April 2009.
c
2009 Association for Computational Linguistics
A Tool for Multi-Word Expression Extraction in Modern Greek
Using Syntactic Parsing
Athina ... (Seretan, 2008) which has previously been
1
For the sake of simplicity, we will henceforth use the
term Greek to refer to Modern Greek.
used to build MWE resources for other languages,
including English, ... rules defined for
Greek, allowing for the complete parse of about
50% of the sentences in a corpus like Europarl
(Koehn, 2005), which contains proceedings of
the European Parliament. For the remaining...
- 4
- 491
- 0
