metallothionein mt was first identified in 1957 by m margosch and b vallee as a cadmium protein from equine kidney cortex in fact
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
Ngày tải lên :
08/03/2014, 08:20
... conformers of Ac -b
2
-HAla-
NHMe obtained with DISCOVER and < /b> AMBER forcefield.
Table S3. Minimum-energy conformers of Ac -b
3
-HAla-
NHMe obtained with DISCOVER and < /b> AMBER forcefield.
Table S4. NMR Parameters ... conformational
space of b- aminoacidsislargerthanthatofa-amino
acids, but low-energy conformations of the b- amino acids
backbone, corresponding to gauche rotamers around the
Ca–Cb bond, can overlap ... cyclase and < /b> (B) a nity for the NK- 1m
< /b> binding site and < /b> potency to activate phospholipase C of b- amino acid-
containing peptide analogues. Symbols are the experimental results
obtained with data in...
- 11
- 860
- 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_1 docx
Ngày tải lên :
21/06/2014, 14:20
... own-brand cola. It was
< /b> alleged that confusion was < /b> being caused to customers wishing to
purchase Coca-Cola because of the similarity.
Details of the law affecting lotteries and < /b> competitions are ... using artwork (ie graphics, charts, drawings line drawings,
cartoons or any original illustrations) it must be camera ready (see
page 36). Normally, finished drawings or paintings are acceptable,
but ... retaining ownership.
Any agreements dealing with copyright must be quite clear as to
whether an assignment of rights or a licence is being granted. Any
assignment must be in < /b> writing. It can be in...
- 17
- 502
- 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
Ngày tải lên :
06/03/2014, 22:21
... 246
BCRP ACATCAGCGGATACTACAGAG CACCATCATAAGGGTAAACAT 173
CA9 TTTGAATGGGCGAGTGATTG ACAGCAAAAAGGAGGCCAAA 138
BMP2 CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83
MT2< /b> A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT ... including renal carcino-
mas and,< /b> particularly, clear cell adenocarcinomas, cer-
vical squamous carcinomas, ovarian carcinomas,
colorectal carcinomas, esophageal carcinomas, bladder
carcinomas ... difluoride) membrane, and < /b> immunoblotting
was < /b> carried out with antibodies against MT2< /b> A (rabbit poly-
clonal antibody produced by < /b> our laboratory), CA9 and < /b> HIF- 1a
(Santa Cruz Biotechnology, Santa Cruz, CA,...
- 13
- 563
- 0
Báo cáo khoa học: Fluorescence quenching and kinetic studies of conformational changes induced by DNA and cAMP binding to cAMP receptor protein from Escherichia coli ppt
Ngày tải lên :
07/03/2014, 16:20
... experiment were purchased from TIB
Molbiol (Poznan, Poland). The DNA sequences are as fol-
lows: 5¢-AAAAGTGTGACATGGAATAAATTAGT-3¢ for
gal (26 bp), 5¢-ATTAATGTGAGTTAGCTCACTCATTA-
3¢ for lac (26 bp), ... total emission spectrum with a maxi-
mum at about 342 nm; (
) the more quenchable component with a
maximum at about 350 nm, characterized by < /b> an average value of
K
SV1
¼ 9.61 M
< /b> )1
and < /b> a fraction ... Fractions displaying an
absorbance at both 280 and < /b> 340 nm were combined and
< /b> dialyzed extensively against buffer B. The stoichiometry of
labeling was < /b> determined spectrophotometrically and < /b> ranged
from...
- 14
- 400
- 0
Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx
Ngày tải lên :
07/03/2014, 21:20
... substrate, increase of absorbance
rate in < /b> the first 2 min was < /b> measured at 340 nm for GST
and < /b> at 405 nm for esterase by < /b> Vmax Kinetic Microplate
Reader (Molecular Devices). GST was < /b> also assayed by
< /b> another ... (1.4)
was < /b> obtained in < /b> both GST assays, and < /b> was < /b> significant at the
5% level. CE activity was < /b> measured by < /b> spectrophotometry.
Clofibrate increased CE activity in < /b> each experiment, but the
increase was < /b> ... harvested at 5, 8
and < /b> 14 h post-treatment. The poly (A) -RNA was < /b> extracted from the
larvae, and < /b> 300 ng mRNA of each sample was < /b> loaded on a gel. Actin
mRNA served as an internal marker to equate mRNA quantities.
Fig....
- 10
- 378
- 0
Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx
Ngày tải lên :
16/03/2014, 00:20
... to act by < /b> liberating BAX
and < /b> BAK from these proteins; in < /b> addition, BOPs dis-
placed by < /b> treatment with ABT-737 may bind and < /b> inhibit
MCL-1, providing further activation of BAX ⁄ BAK.
ABT-737 can ... failed to increase BIM
expression, the combination of PD0325901 and < /b> rapa-
mycin was < /b> more effective than PD0325901 alone, and
< /b> death arising from the combination therapy was < /b> at
least partially BIM-dependent ... be a problem clinically, and < /b> 40%
of patients who relapse on imatinib therapy have point
mutations in < /b> the BCR–ABL kinase domain, including
the T315I gatekeeper mutation that impairs imatinib
binding...
- 13
- 453
- 0
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt
Ngày tải lên :
16/03/2014, 05:20
... concentration was
< /b> adjusted to 4 lm by < /b> dilution with the equilibrium buffer.
Equilibrium dialysis was < /b> performed in < /b> plastic cell compart-
ments separated with partially permeable membrane tubing
made from ... iron transport
and < /b> regulation, and < /b> are found widely in < /b> vertebrates
and < /b> invertebrates [25–27]. Mammalian transferrin can
also bind various trace metals, including manganese,
copper, and < /b> zinc, although ... respectively. The molar ratio of zinc to MYP (as a
monomer) was < /b> calculated. (B) Purified MYP was < /b> subjected to
SDS ⁄ PAGE, and < /b> the protein levels in < /b> the CFMYP and < /b> EGMYP
bands were measured by < /b> densitometry...
- 14
- 442
- 0
Báo cáo Y học: Purification and characterization of VanXYC, a D,D-dipeptidase/D,D-carboxypeptidase in vancomycin-resistant Enterococcus gallinarum BM4174 docx
Ngày tải lên :
18/03/2014, 01:20
... lLof1 0m
< /b> MD
-Ala-
D
-Ala was < /b> added, incubated at
37 °C for 30 min, and < /b> assayed using the
D
-amino acid
oxidase assay. This experiment was < /b> repeated to determine
the effect of divalent cations on
D
,
D
-carboxypeptidase
activity, ... suitable time points and < /b> added to 750 lLof
cadmium- ninhydrin stock solution; 70 lL of distilled water
was < /b> added and < /b> incubated at 85 °C for 5 min. The absorb-
ance was < /b> measured at 505 nm and < /b> quantified ... Plas-
mid pAP1 (encoding a maltose binding protein- VanXY
C
fusion protein) was < /b> constructed as follows; Pfu polymerase
(Stratagene) was < /b> used to amplify vanXY
C
usingpAT70 4as
template with primers...
- 7
- 414
- 0
English Solutions for Engineering and Sciences Research Writing: A guide for English learners to publish in international journals ppt
Ngày tải lên :
19/03/2014, 08:20
... writing and < /b> common format punctuation errors were
expanded and < /b> revised but removed from this book and < /b> made into separate files available at
www.hanyangowl.org.
The first < /b> edition was < /b> based ... corrections are welcome: adamturner7@gmail.com
2. It is based on computer analysis of authentic texts
All the best practices and < /b> examples are directly taken from computer analysis of real published ...
http://www.hanyangowl.org/media/computerassisted/mswordskillscombined.pdf
Biomedical researchers can download a separate guide to biomedial writing PDF ebook
http://www.hanyangowl.org/media/biomedical/handbookbiomedicalwriting.pdf...
- 186
- 615
- 0
Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx
Ngày tải lên :
23/03/2014, 21:20
... tetra-
zolium bromide (MTT), and < /b> calcein were obtained from
Sigma, and < /b> fetal bovine serum was < /b> from Euroclone
(Wetnerby, UK).
Hemolytic activity
Hemolytic activity was < /b> measured by < /b> a turbidimetric ... 1080 from human
fibrosarcoma and < /b> MCF 7 from human breast adenocarci-
noma, were obtained from the Istituto Zooprofilattico
Sperimentale della Lombardia e dell’Emilia, Brescia, Italy.
Lipids. A series ... in < /b> Hanks balanced salt solution, Bacillus sp.
and < /b> Serratia marcescens proteases, Saccharomyces cerevisiae
proteinase A, and < /b> Clostridium perfringens neuraminidase
were all supplied by < /b> Sigma.
Cells....
- 12
- 492
- 0
báo cáo hóa học: " Increased circulating leukocyte numbers and altered macrophage phenotype correlate with the altered immune response to brain injury in metallothionein (MT) -I/II null mutant mice" doc
Ngày tải lên :
19/06/2014, 22:20
... mm anterior of lambda
and < /b> 2 mm right of the midline. The skin was < /b> sutured
and < /b> the animal was < /b> allowed to recover back in < /b> its origi-
nal cage. Mortality rate was < /b> less than 1% with a few ani-
mals ... as the house
keeping gene and < /b> MT-< /b> I and < /b> MT-< /b> II mRNA copy numbers
were standardized to the copy number of the house-keep-
ing gene, GAPDH.
Plasma cytokine assay
Blood was < /b> collected from mice via ... (grey bars) standardised to
injury area. Neutrophil numbers (A) were determined by < /b> NIMP-14 immunoreactivity. Microglial and < /b> monocyte derived macrophages numbers
(B) were determined by < /b> Iba1 immunoreactivity....
- 11
- 460
- 0
- was recently identified in human peripheral blood monocytes treated with monocyte chemotactic protein 1 mcp1 and in human monocytederived macrophages stimulated with interleukin il1b these experiments revealed that the gene undergoes rapid and potent
- chulalongkorn university in thailand this smalllab kit was created as a result of the research project entitled chemistry laboratory based on chemical safety and pollution minimization sponsored by thai research fund rdg 3072543 one of the outcomes of t
- this schedule was first published
- mythological creatures and the chinese zodiac in origami by john montroll
- mythological creatures and the chinese zodiac in origami by john montroll pdf
- the most common disease produced in humans by cryptococcus is
- fundamentals of data structures in c by horowitz sahni and mehta
- fundamentals of data structures in c by horowitz sahni and mehta ppt
- fundamentals of data structures in c by horowitz sahni and mehta pdf
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2