linear algebra and its applications by david c lay third edition

Báo cáo khoa học: Characterization of testis-specific serine–threonine kinase 3 and its activation by phosphoinositide-dependent kinase-1-dependent signalling doc

Báo cáo khoa học: Characterization of testis-specific serine–threonine kinase 3 and its activation by phosphoinositide-dependent kinase-1-dependent signalling doc

Ngày tải lên : 23/03/2014, 11:20
... (GCGCTGTCGACCATGGAGGACTT TCTGCTCT CATTGAATTCCTCAAGTGCTTGCTAGC CATG). The forward (5Â) primer contained a SalI site, whereas the reverse (3Â) primer contained an EcoRI site. The amplied products ... GGTGGTCATATGGAGG ACTTTCTRCTCT ⁄ CACTTGCCATTGCTTTTATCA and ligated into SmaI site of pUC 18 vector. The E. coli pGEX–mTSSK3 or pGEX–hTSSK3 plasmids were constructed using pGEX)4T-2, which expresses ... and Biophysics, Polish Academy of Sciences, Warsaw, Poland 3 Department of Physiological Chemistry and Center for Biomedical Genetics, University Medical Center Utrecht, the Netherlands Phosphorylation...
  • 14
  • 374
  • 0
Hydraulic modeling of open channel flows over an arbitrary 3-d surface and its applications in amenity hydraulic engineering

Hydraulic modeling of open channel flows over an arbitrary 3-d surface and its applications in amenity hydraulic engineering

Ngày tải lên : 06/11/2012, 10:35
... surfaces such as flows over stepped chute, cascade, spillway, etc and the alike. In such cases, these models can not reproduce the effects of the bottom topography (e.g., centrifugal force due ... nonorthogonal curvilinear coordinates for prediction of flow pattern in meandering channel with 60 o and 90 o bend, and also with compound meandering channel. In this study, the Cartesian velocity components ... or /and with an existing empirical formula to show the applicability and effectiveness of the model. 1.4 Scope of Study The manuscript consists of eight chapters including the Introduction and...
  • 127
  • 595
  • 0
Real-Time Digital Signal Processing - Chapter 7: Fast Fourier Transform and Its Applications

Real-Time Digital Signal Processing - Chapter 7: Fast Fourier Transform and Its Applications

Ngày tải lên : 28/10/2013, 05:15
... experiments. 2. Create the project exp7a using CCS. Add the command file exp7.cmd, the functions epx7a .c, fft_a .c, andibit_rev .c, and the header file icomplex.h from the software package into the project. 340 FAST ... scaling technique achieves much better accuracy since we may scale less often than the uncon- ditional scaling method. However, this conditional scaling method increases software complexity and ... Experiment 7C: 1. Create the project epx 7c and include the files exp7.cmd, exp 7c. c, w_table .c, fft.asm, and bit_rev.asm from the software package into the project. 2. Build and view the IFFT results by...
  • 47
  • 634
  • 0
Tài liệu Báo cáo khoa học: Characterization of electrogenic bromosulfophthalein transport in carnation petal microsomes and its inhibition by antibodies against bilitranslocase docx

Tài liệu Báo cáo khoa học: Characterization of electrogenic bromosulfophthalein transport in carnation petal microsomes and its inhibition by antibodies against bilitranslocase docx

Ngày tải lên : 20/02/2014, 01:20
... complexes of bilitranslocase with bilirubin, nicotinic acid and cyanidin 3-glucoside, sections C and D). A Michaelis–Menten constants of BSP electrogenic uptake (K M , lM) Carnation Liver 5.28 ± ... Cocolo 1 , Enrico Braidot 2 , Elisa Petrussa 2 , Carlo Peresson 2 , Nevenka Medic 1 , Francesco Macri 2 and Angelo Vianello 2 1 Dipartimento di Biochimica Biofisica e Chimica delle Macromolecole, Universita ` di ... known to randomly revert by freezing and thawing the vesicle suspension. Because as many as three cycles of freezing and thawing did not decrease the speci c activity of BSP electrogenic uptake,...
  • 15
  • 589
  • 0
Báo cáo khoa học: Oligosaccharide synthesis in Fibrobacter succinogenes S85 and its modulation by the substrate potx

Báo cáo khoa học: Oligosaccharide synthesis in Fibrobacter succinogenes S85 and its modulation by the substrate potx

Ngày tải lên : 07/03/2014, 17:20
... metabolism of MDs in F. succinogenes. These Table 1. Production of succinate and acetate by Fibrobacter succin- ogenes grown on various carbon sources. CB, cellobiose; Glc, glu- cose; M2, maltose; M3, ... the culture media after 48 h. Average standard deviations were ± 0.7 and 0.2 for acetate and succinate, respectively. Concentration ⁄ m M Concentration ⁄ mM Sugar Succinate Acetate Sugar Succinate ... 45 37.5 30 22.5 15 7.5 0 45 37.5 30 22.5 15 7.5 0 45 37.5 30 22.5 15 7.5 0 60 52.5 45 37.5 30 22.5 15 7.5 0 1.5 1.25 1 0.75 0.5 0.25 concentration (mM)concentration (mM) concentration (mM)concentration (mM) concentration (mM) concentration (mM) concentration (mM) concentration (mM) 0 01020 time (min) S A B C D S S SE E E E time...
  • 12
  • 406
  • 0
Báo cáo khoa học: "A Statistical Tree Annotator and Its Applications" pptx

Báo cáo khoa học: "A Statistical Tree Annotator and Its Applications" pptx

Ngày tải lên : 07/03/2014, 22:20
... first application is to predict function tags of an input syntactic parse tree; the sec- ond one is to predict Chinese empty elements; and the third one is to predict whether a syntactic con- stituent ... the lexical features and it helps quite a bit by improving the accuracy by 0.64%. When all features are used, the system reached an accuracy of 97.34%. From these results, we can conclude that, ... prediction and recov- ery with unlexicalized PCFGs and slash features. In Proceedings of the 21st International Conference on Computational Linguistics and 44th Annual Meet- ing of the Association...
  • 9
  • 421
  • 0
Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot

Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot

Ngày tải lên : 08/03/2014, 09:20
... of 169 Yb complexes in normal and tumour cells: influence of ligand and metabolic cell activity and stability of cellular association. Nucl. Med. Biol. 24, 349–355. 6. Evans, C. H. (1990) Biochemistry ... the cells after incubation with FITC-Yb 2 -Tf by flow cytometric technique based on the fluorescence excited at 488 nm. As shown in Fig. 7A, the mean channel fluorescence intensity (  FF), which ... mean channel fluorescence intensity (  FF), which was obtained by integrating the intensity per cell from 1 · 10 4 cells for each sample. Laser scanning confocal microscopy Entry of FITC-Yb-Tf...
  • 9
  • 385
  • 0
BIOTECHNOLOGY and its APPLICATIONS

BIOTECHNOLOGY and its APPLICATIONS

Ngày tải lên : 13/03/2014, 21:48
... manufactured in commercial quantities. Commodity chemicals (e.g., polymer-grade acrylamide) and specialty chemicals can be produced using biotech applications. Traditional chemical synthesis ... agricultural crops, such as corn, can be used in place of petroleum to produce chemicals. The crop’s sugar can be fermented to acid, which can be then used as an intermediate to produce other chemical ... develop crops with specific beneficial traits and reduce undesirable traits (10). Traditional biotechnology such as cross-pollination in corn produces numerous, non-selective changes. Genetic modifications...
  • 13
  • 393
  • 0
Báo cáo khoa học: Structural flexibility of the methanogenic-type seryl-tRNA synthetase active site and its implication for specific substrate recognition pptx

Báo cáo khoa học: Structural flexibility of the methanogenic-type seryl-tRNA synthetase active site and its implication for specific substrate recognition pptx

Ngày tải lên : 16/03/2014, 06:20
... 5Â-CGGAATCGAA GCGGTCGACGAGTTCCACAGG 5Â-CCTGTGGAACTCGTCGACC GCTTCGATTCCG W396A SOL 5Â-GAAAAGCAAGAGTTACCCCC GCGTTTATGGCACAGGAAG 5Â-CTTCCTGTGCCATAAAC GCGGGGGTAACTCTTGCTTTTC N435A Between SOL and M3 5Â-GCTTGAGTTCCAG GCTGTGAGCATCAATGGAGATAAGTATC 5Â-GATACTTATCTCCATTGATGCTCACA GCCTGGAACTCAAGC S437A ... 5Â-CCCACAGGTATG CGAGTGGTGGAATTCACGG 5Â-CCGTGAATTCCACCACTC GCATACCTGTGGG G340V G341A Motif 2 loop 5Â-CCACAGGTATGAGAGTG TTGCAATTCACGGAATCGAAAGG 5Â-CCTTTCGATTCCGTGAATT GCAACACTCTCATACCTGTGG R347A Motif 2 loop 5Â-CGGAATCGAA GCGGTCGACGAGTTCCACAGG 5Â-CCTGTGGAACTCGTCGACC GCTTCGATTCCG W396A ... 5Â-GCTTGAGTTCCAG GCTGTGAGCATCAATGGAGATAAGTATC 5Â-GATACTTATCTCCATTGATGCTCACA GCCTGGAACTCAAGC S437A Between SOL and M3 5Â-GGCTTGAGTTCCAGAATGTG GCCATCAATGGAGATAAG 5Â-CTTATCTCCATTGATG GCCACATTCTGGAACTCAAGCC N435A...
  • 14
  • 357
  • 0
Ischemic Heart Disease Edited by David C. Gaze doc

Ischemic Heart Disease Edited by David C. Gaze doc

Ngày tải lên : 16/03/2014, 21:20
... Jr., Homcy CJ, Vatner SF. One hour of myocardial ischemia in conscious dogs increases beta-adrenergic receptors, but decreases adenylate cyclase activity. Journal of Molecular and Cellular Cardiology (1988). ... myocardial cell death due to prolonged ischemia. Cell death is categorized pathologically by coagulation necrosis and/ or contraction band necrosis, which usually evolves through oncosis, but can ... In contraction band necrosis and colliquative myocytolysis, healing is thought to occur by fibroblastic proliferation, without the usual sequence of changes that occurs with coagulation necrosis....
  • 210
  • 458
  • 0
Gene Therapy - Tools and Potential Applications by Francisco Martin Molina Contributors ppt

Gene Therapy - Tools and Potential Applications by Francisco Martin Molina Contributors ppt

Ngày tải lên : 17/03/2014, 21:20
... 5’-AATCCATCTTGCTCCAA‐ CAC-3’ Rev- 5’ATCTCTTTTTCCGTCATCGTC-3’). PCR conditions were: Initial denatura‐ tion at 95 C for 15mins followed by 35 cycles (95 C for 1 min, 60 C for 1 min, 72 C for ... (Days) pUb pCMV pGL3 Average Luminescence p/sec/cm^2/sr/Gene Copy Average Luminescence p/sec/cm^2/sr/Gene Copy Average Luminescence p/sec/cm^2/sr/Gene Copy pCMV-luc Liver & Muscle pUb-luc Liver ... the landmark publications in the late 1980s [80]. Cationic lipids can condense nu‐ cleic acids into cationic particles when the components are mixed together. This cationic lipid/nucleic acid complex...
  • 754
  • 589
  • 0
symbolic space french enlightenment architecture and its legacy by richard a etlin

symbolic space french enlightenment architecture and its legacy by richard a etlin

Ngày tải lên : 21/03/2014, 22:51
... Detailed book review, subject could also be French Architecture Richard A. Etlin, Symbolic Space: French Enlightenment Architecture and Its Legacy. Chicago: The University of Chicago Press, 1994; xxv ... Politics, science, social organization, and religion, all have spaces unique to their own functional character. Beyond a functional character, however, there exists a deeper, more spiritual connection ... that affect the viewer and the user." Architecture can establish a meaning and a feeling; it will affect man's mood. The mood is created and controlled by an architect's use and design...
  • 4
  • 473
  • 0
Báo cáo khoa học: Hepatocyte growth factor activator (HGFA): its regulation by protein C inhibitor ppt

Báo cáo khoa học: Hepatocyte growth factor activator (HGFA): its regulation by protein C inhibitor ppt

Ngày tải lên : 22/03/2014, 21:21
... findings suggest that APC protects hepatic nonparenchymal cells from thrombin-induced inflammation, and that plasma PCI in hPCI-Tg mice inhibits the cytoprotective action of APC and may also inhibit ... PCI in hPCI-Tg mice inhibits the cytoprotective activity of APC The anticoagulant protease APC has marked cytopro- tective and anti-inflammatory activities [31,32], and it is generated from its ... representation of molecular homology between APC–PCI (left) and HGFA–PCI (right). APC (green), HGFA (red–orange) and PCI (gray) are shown as ribbon models. In each complex, acidic and basic amino acids are...
  • 7
  • 291
  • 0

Xem thêm