lesions elevated levels of secreted il 16 correspond to increased cd4 th1 infiltration and signaling as measured by t bet expression and stat 1 phosphorylation
báo cáo hóa học: " Secretory PLA2-IIA: a new inflammatory factor for Alzheimer''''s disease" pot
Ngày tải lên :
19/06/2014, 22:20
... events resulting from astrocyte activation Taken together, these results are in agreement with the ability of pro-inflammatory cytokines and Aβ to mediate inflammatory responses in astrocytes ... observed upon stimulating astrocytes with A 1 42 and IL- 1 When A 1 42 and IL- 1 were given together, there was no further enhancement of sPLA2-IIA mRNA expression, compared to each treatment alone ... 5'- GACTCATGACTGTTGTTACAACC-3' and reverse 5'-TCTCAGGACTCTCTTAGGTACTA-3' that amplify a 493 bp fragment, and primers for β-actin are: forward 5'-TGGAGAAGAGCTATGAGCTGCCTG-3' and reverse 5'-GTGCCACCAGACAGCACTGTGTTG-3'...
- 11
- 389
- 0
báo cáo khoa học: "Application of in situ reverse trancriptase-polymerase chain reaction (RT-PCR) to tissue microarrays" pot
Ngày tải lên :
11/08/2014, 00:21
... Whilst the standard de-waxing step was carried out to remove the embedding material, the extensive deoxyribonuclease (DNAse) treatment step [6] was omitted in order to better preserve structural ... identification of cells difficult In our protocol, the DNAse digestion step was omitted so as to better preserve tissue structure Modifications to experimental design were employed to prevent amplification ... thirty minutes The tissue was counter-stained with hematoxylin (Dako Ltd., Glostrup, Denmark) and images were captured by a digital camera attached to a light microscope References 10 11 12 13 ...
- 5
- 254
- 0
Phát hiện và phân biệt chủng virus gây hội chứng rối loạn sinh sản và hô hấp ở lợn bằng phương pháp multiplex RT PCR (reverse transcription polymerase chain reaction)
Ngày tải lên :
30/11/2015, 20:08
... CSFV-R Trình t mồi [5’ – 3’] CAG CCA GTC AAT CAG CTG TG GAA CGT TCG GTC TGG GTG AG ATC CTC CCT GAA TCT GAC AGG TGG GTG GCA GAA AAG CTG TT GTG TCA ATC AGT GCC ATT GAC C TCC CGT ATT TTC TTG CGC TC ... CT2 012 .HS2 Can Tho - 2 012 JQ860 417 CT2 012 .HS3 Can Tho - 2 012 JQ860 418 CT2 012 .C1 Can Tho - 2 012 JQ860 414 10 CT2 012 .C2 Can Tho - 2 012 JQ860 415 11 DT2 012 .DT7 Dong Thap - 2 012 JQ860 419 12 DT2 012 .DT8 ... GAT GCC ATT TTT CCT TCT CC AAC ATG GAT GGT GTA ACT GG TCT CTA TAG TGT TGG TCA TTC C Ta [oC] 55 55 53 54 Kích thƣớc sản phẩm PCR [bp] 16 1 245 490 387 342 PRRSV1 dùng cho phản ứng multiplex RT-PCR,...
- 79
- 522
- 0
Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction
Ngày tải lên :
10/02/2014, 20:39
... GTGACAGGATTGGTCTTGTCTT 15 8 -13 9 55.8 DiagH5F AGTGATCAGATTTGCATTGGTTAC 46-69 54.6 DiagH5R GACCAAGAACTTTTGGGGATG 416 - 396 55.4 DiagN1F CCAGTTGGTTGACAATTGGAAT 503-524 54.5 DiagN1R GCATCAGGATAACAGGAGCA ... “Glycosylation of haemagglutinin and stalk-length of neuraminidase combine to regulate the growth of avian influenza viruses in tissue culture” Virus Res, 79 (1- 2): 17 7 -18 5 Beare AS and Webster RG (19 91) , ... ̣c thiế t kế để thực hiê ̣n phản ứng mutiplex RT-PCR pha t hiê ̣n virus cúm A/H5N1 bảng: Mồ i Trình t ̣ 5’-3’ Vị trí Tm DiagMF GTCTTCTAACCGAGGTCGAAAC 5-26 55 .1 DiagMR GTGACAGGATTGGTCTTGTCTT...
- 11
- 581
- 0
Báo cáo khoa học: "TaqMan reverse transcription polymerase chain reaction for the detection of Japanese encephalitis virus" pot
Ngày tải lên :
07/08/2014, 18:20
... sensitive TaqMan probe The detection limit of the real-time RT-PCR was calculated to be 11 .2 TCID50/ml (Table 2) This result of detection limit was similar to that of the previous study [12 ] The ... GGTGTA AGGACTAGA GGTTAG AGG ATTCCC AGGTGTCAATATGCTGTT 6Fam-CCCGTGGAAACAACATCATGCGGC-Tamra 10 ,726 -10 ,750 10 ,848 -10 ,8 71 10,754 -10 ,777 3' NTR 14 6 bp *Nucleotide sequence position according to KV1899 ... × 10 1.0 TCID50/reaction Real-time RT-PCR assay could detect JE RNA ranging from 1. 12 × 10 6.0 to 1. 12 × 10 1.0 TCID50/ml Therefore, detection limits of RT-PCR and real-time RTPCR were 11 2 TCID50/ml...
- 7
- 334
- 1
Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps
Ngày tải lên :
07/08/2014, 18:21
... sah sdohtem RCP-TR htoB VDMF fo noitceted eht rof sdohtem citsongaid rehto eht naht evitisnes erom saw RCP-TR T/ R ehT ASILE-gA htiw lellarap ni RCP-TR lanoitnevnoc dna T/ R eht yb detset T 05 05 ... eht ,sloot citsongaid rehto yb esoht htiw RCP-TR T/ R yb deniatbo stluser eht erapmoc oT 05 stset rehto dna RCP-TR T/ R fo timil noitceted eht fo nosirapmoC evitagen deredisnoc saw elpmas eht ,selcyc ... RCP-TR T/ R ehT ASILE-gA yb detset nehw devresbo saw noitceted negitna on saerehw ,lm/ DICT 01 fo noitartnecnoc ANR lariv eht saw RCP-TR lanoitnevnoc eht fo timil noitceted ehT RCP -TR T/ R eht ni...
- 6
- 347
- 0
Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx
Ngày tải lên :
11/08/2014, 08:20
... corrected quantity of CD4 and CD8 mRNA as determined by QC-RT-PCR and the corresponding CD4 and CD8 counts of that patient as determined by flow cytometry are depicted in Table The patients' HIV status, ... QC-RT-PCR and related techniques such as real-time PCR are not useful as substitutes for assessment of CD4 and CD8 cell status in HIV-infection by flow cytometry Methods QC-RT-PCR The strategy ... of quantifying mRNA levels We therefore set out to develop an RT-PCR based method to quantitate CD4 and CD8 mRNA in the hopes that this could be used to predict cell counts Although it has long...
- 4
- 319
- 0
Xây dựng qui trình phát hiện đồng thời yeallow head virus(YHV), taura syndrome virus(TSV) và gill associated virus(GAV) trên tôm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction
Ngày tải lên :
31/08/2014, 07:43
... 5’-ACCGACATCGACATACAAATCCCAATC-3’ 58,8 290bp 496bp GAVr 5’-CCGTCTGTTGTTCGAGAAATTCAACAATC-3’ 58,3 TSVf 5’- TCAGCTTCGACAGTCTCTCCTAATATTG-3’ 57,6 TSVr 5’-TCAATTATCCAGCAGATGTTCCTGAGG-3’ 58,4 13 0bp 28 2 .1. 4 ... cặp mồi thi t kế công ty IDT t ng hợp trình bày bảng sau: Bảng 1: Trình t mồi Sản T n mồi Trình t mồi Tm (0C) phẩm PCR YHVf 5’-TTGTGAATGTAGCCGTCAGTCGTT-3’ 58,6 YHVr 5’-CCGTTTGAAACTCTCAAAGAAGCC-3’ ... 13 1. 2 .1. 1 Hình thái cấu trúc 13 1. 2 .1. 2 Cách thức lan truyền 13 1. 2 .1. 3 Dấu hiệu bệnh lý 14 1. 2.2 Taura syndrome virus (TSV) 15 1. 2.2 .1 Hình thái...
- 59
- 363
- 0
Báo cáo y học: " A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus" pptx
Ngày tải lên :
12/08/2014, 04:20
... such as CCV, CPV, CAV, RV, and uninfected cells control, indicating the high specificity of the method The method was sensitive, in that it could detect as little as 0 .1 TCID50 of the virus The ... vaccine strain were subjected to amplification by multiplex RT-nPCR The lowest limit of detection with this method was shown to be 0 .1 TCID50 Of the 30 field samples, 20 tested positive for CDV, ... strains, CPV, CAV, CCV, RV, NDV, and uninfected cells to test its specificity Extracted RNA from serially diluted (10 4, 10 3, 10 2, 10 1, 10 0, 10 -1, 10 -2, 10 -3 TCID50) CDV cell cultures (10 6.5 TCID50/mL)...
- 6
- 480
- 0
Báo cáo hóa học: "Detection of carcinoembryonic antigen messenger RNA in blood using quantitative real-time reverse transcriptase-polymerase chain reaction to predict recurrence of gastric adenocarcinoma" potx
Ngày tải lên :
18/06/2014, 16:20
... mRNA) × 10 6 in this group of patients 0.063 Sex Female 41 12 29 Male 82 33 49 T1 10 T2 16 13 T3 T4 73 24 26 10 47 14 N0 31 11 20 N1 43 15 28 N2 29 21 N3 20 11 I 16 II 21 15 III IV 51 35 17 15 34 ... metastasis, other sites metastasis and 10 multiple sites metastasis There is no significant difference between the CEA mRNA expression and the mode of recurrence (Table 1) Recurrent disease was ... lymphocytes of the host, and the sensitized T lymphocytes may attack the residual micrometastatic cancer lesions of the patients [23] To clarify this hypothesis, further investigations regarding the...
- 8
- 439
- 0
Báo cáo y học: "Expression analysis of three isoforms of hyaluronan synthase and hyaluronidase in the synovium of knees in osteoarthritis and rheumatoid arthritis by quantitative real-time reverse transcriptase polymerase chain reaction" potx
Ngày tải lên :
09/08/2014, 01:24
... 10 05 – 9 81 TCATGGATTTCCTTCCTGAGCAGCGT 913 – 938 15 61F AGTGGTGCTCTGGGTGAGCT 15 61 – 15 80 16 6 7R TGGTCACGTTCAGGATGAAGG 16 6 7 – 16 4 7 probe CCAAGGAATCATGTCAGGCCATCAAGG 15 96 – 16 2 2 10 69F CGCAGCTGGTGTCATCCTCT ... CGCAGCTGGTGTCATCCTCT 10 69 – 10 88 11 59R CAGCAGCCGTGTCAGGTAATC 11 59 – 11 39 probe TACACCACAAGCACGGAGACCTGCC 11 03 – 11 27 11 30F GCCTCACACACCGGAGATCT 11 30 – 11 49 12 02R GCTGCACTCACACCAATGGA 12 02 – 11 83 probe ... HYAL-3 14 9 – 12 7 probe HYAL-2 ACACTGCTGAGGAATGAGATCCA 10 05R HYAL -1 CTATGCTTGACCCAGCCTCATC MGB probea HAS-3 TATCCTGCATCAGCGGTCCTCTAGGC 20F 14 9R HAS-2 TCCTGTCCCAGGATGACCTTGTGCA 11 57 – 11 81 20 – 41 aMinor...
- 7
- 466
- 0
Báo cáo y học: " A duplex real-time reverse transcriptase polymerase chain reaction assay for detecting western equine and eastern equine encephalitis viruses?" docx
Ngày tải lên :
12/08/2014, 01:22
... Nucleotide start EEE-F TGTGCGTACCTCCTCATCGTT 335 EEE-R GACTGGCGTGAATCTCTGCTT 414 EEE-Probe HEX364 AGCAGCCTACCTTTCCGACAATGGTTGTCTAMRA WEE-F AGGGATACCCCCGAAGGTT 8220 WEE-R GTGAATAGCACACGGGTGGTT 8322 ... contributions XK: designed the study, did laboratory testing, analysed the test results, cowrote and edited the manuscript YL, H L, FL, XC, TS and GC took samples and did laboratory testing QZ and ... solutions of the in vitro-transcribed RNA were stored at -70°C, and the diluted working solutions were stored at -20°C [5] Sensitivity and specificity of the duplex real-time RT-PCR assay The sensitivity...
- 5
- 278
- 0
Báo cáo y học: " A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control" docx
Ngày tải lên :
12/08/2014, 04:20
... 5'-AGCGTCTAGCCATGGCGTTAGTAT-3' 74 97 Ba 5'-TCCTCGCAATTCCGGTGTACTC-3' 16 1 18 2 Bp FAM5'-CCCCCCTCCCGGGAGAGCCATAGT-3' BHQ 12 1 14 4 ICp Cy55'-TTCCGCTGCCTGCTCAGTCGATCC-3' BHQ BHQ: Black Hole Quencher dye and ... http://www.virologyj.com/content/7 /1/ 117 Page of Table 3: Reproducibility of the duplex real-time RT-PCR assay Reproducibility Target HCV RNA (IU/ml) Number of determinations Mean Ct SD CV (%) Intra-assay 10 5 10 27 .15 ... the study of Chevaliez et al [30], the CAP/CTM assay failed to detect HCV genotype Thus, the testing results of the duplex real-time RT-PCR for the 10 9 serum samples, which were identical to those...
- 9
- 322
- 0
Báo cáo y học: "Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR) for diagnosis of natural infection with canine distemper virus" potx
Ngày tải lên :
12/08/2014, 04:20
... amplification were F-vacc: 5'CATCAGCCATGATCAGGGTCTTTTC-3' and R-vacc: 5'-GGGCGGTCTTGTTGGGTATGTGTTT-3' The primers used for field strain amplification were F-wt: 5'AATTCCCAAAAAATCCAAACCCTGC-3' and R-wt: ... editorial assistance and Taichung City Animal Protection and Health Inspection Center, Taichung, Taiwan for the sample collection This study was supported by the Bureau of Animal and Plant Health ... Inspection and Quarantine, the Council of Agriculture (grant number: GA9 710 4), and National Scientific Council (grant number: NSC962 313 -B-005- 016 - MY3), Taiwan Author Details 1Department of Veterinary...
- 9
- 345
- 0
Báo cáo khoa học: " An analysis of the subtypes of dengue fever infections in Barbados 2003–2007 by reverse transcriptase polymerase chain reaction" pptx
Ngày tải lên :
12/08/2014, 04:21
... 18 16 15 15 13 12 11 11 5 4 1 69 63 52 32 15 15 13 12 12 11 10 9 4 3 0.8 0.8 0.8 Page of (page number not for citation purposes) Virology Journal 2008, 5 :15 2 Lanes Lanes A 10 11 A 12 13 14 15 16 ... 2 15 13 28 2 1 1 14 1 1 10 18 5 1 16 22 31 10 12 10 12 17 32 29 71 1 01 172 2004 2005 2006 2007 Total Total endemic in the Caribbean sub-region, producing numerous epidemics at irregular intervals ... clinical and laboratory features, at least 4% of patients had suggestive symptoms This figure gives an average of at least 16 cases of DHF/ DSS per year based on the number of patients with IgG antibodies...
- 6
- 354
- 0
Báo cáo thú y: " DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) technique among various cell types of bulls" pot
Ngày tải lên :
12/08/2014, 18:22
... TGCCGGCTTG 24 ACCTCCGGTC 10 CCCCGGTAAC 25 CTCCGGATCA 11 CAGTGCCGGT 26 TTTCCGGGAG 12 ACCGGCTTGT 27 AGGCCGGTCA 13 GTCCGGAGTG 28 CAACCGGTCT 14 15 ACACCGGAAC CCCGGATGGT 29 30 CCGCCGGTAA TCCGGGACTC ... culmination of DNA Phutikanit et al Acta Veterinaria Scandinavica 2 010 , 52 :18 http://www.actavetscand.com/content/52 /1/ 18 14 15 16 17 18 19 20 21 Page of marker technologies based on arbitrarily-primed ... genomic and digested DNA template (Fig 1a), indicating that the location is resistant to the enzymatic digestion by the protection of the methylation Phutikanit et al Acta Veterinaria Scandinavica...
- 9
- 258
- 0
Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm A H5N1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reacti
Ngày tải lên :
31/03/2015, 16:19
... cúm A bảng 3 .1: Bảng 3 .1: Cặp mồi ph t gen M virus cúm A T n mồ i Trình t 5’-3’ Vị trí DiagMF GTCTTCTAACCGAGGTCGAAAC 5-26 DiagMR GTGACAGGATTGGTCTTGTCTT 15 8 -13 9 55.8 45.5 Tm %GC 55 .1 50 Cặp mồ ... Bảng 3.2: Cặp mồi ph t gen HA virus cúm A/H5N1 T n mồ i Trình t 5’-3’ Vị trí DiagH5F AGTGATCAGATTTGCATTGGTTAC DiagH5R Tm %GC 46-69 54.6 37.5 55.4 47.6 GACCAAGAACTTTTGGGGATG 416 - 396 Mồi xuôi (DiagH5F) ... lớn ca t vong xảy bệnh nhân 13 tuổi, cúm A/H5N1 gây t lệ t vong cao trẻ nhỏ Ở trẻ 15 tuổi, t lệ t vong 89% [16 ] Thời gian trung bình t có triệu chứng đến t vong 9 -10 ngày (thay đổi t 6-30...
- 79
- 664
- 0
Recombinant DNA I - Basics of molecular cloning Polymerase chain reaction cDNA clones and screening
Ngày tải lên :
13/03/2014, 18:39
... different sources together with DNA ligase Restriction endonucleases generate ends that facilitate mixing and matching GAATTC CTTAAG GAATTC CTTAAG EcoRI cut G AATTC CTTAA G G AATTC CTTAA G Mix and ... ligate G AATTC CTTAA G Recombinant molecules G AATTC CTTAA G GAATTC CTTAAG GAATTC CTTAAG Parental molecules DNA ligase covalently joins two DNA molecules • Uses ATP or NADH to provide energy to ... levansucrase, which converts sucrose to levan, a compound toxic to the bacteria Cut with restriction enzyme E, remove “stuffer” Ligate to very large fragments of genomic DNA promoter S Cm(R) Not to...
- 23
- 460
- 0
ỨNG DỤNG PHƯƠNG PHÁP PCR (POLYMERASE CHAIN REACTION) VÀ PHƯƠNG PHÁP NUÔI CẤY ĐỂ KHẢO SÁT SỰ NHIỄM VI SINH VẬT GÂY BỆNH TRONG THỰC PHẨM ĐƯỜNG PHỐ
Ngày tải lên :
16/03/2013, 09:26
... BC1: ATTGGTGACACCGATCAAACA BC2: GAATAACATCCATACGTATGA Pl3: AAGTTACCTTTGCTGCATAATCCC perfringens Clostridium Pl7: ATAGATACTCCATATCATCCTGCT Salmonella invA1: TTGTTACGGCTATTTTGACCA invA2: CTGACTGCTACCTTGCTGATG ... ứng PCR STT Vi khuẩn Trình t mồi t 5’ - 3’ EC1: CTTCACCCGGTTGCCAGAGG E coli Ec2: GGTGATTACCGACGAAAACGG SA1: GCGATTGATGGTGATACGGTT aureus Staphylococcus SA2: AGCCAAGCCTTGACGAACTAAAGC Bacillus cereus ... gây viêm ru t trẻ sơ sinh, đặc bi t nước nhi t đới gây t lệ t vong cao EPEC gây tiêu chảy t ơng t ETEC chế hồn t n khác Hầu h t chủng EPEC khơng t o độc t LT, ST hay VT (vero cytotoxin) số...
- 84
- 1.8K
- 7
KỸ THUẬT PCR (POLYMERASE CHAIN REACTION)
Ngày tải lên :
24/04/2013, 15:41
... ACTTTCTACTTCGATGACAGAAGA GGATTATTTGTACAAGATAATGTG ’ Gen GAL4 CCTAATAAACATGTTCTATTACAC 5’ 3’ – CCTAATAAACATGTTCTACCTAGG – 5’ Mồi PCR EcoRI BamHI 5’ – GAATTCATGAAGCTACTGTCTTCT 3’ – CTTAAGTACTTCGATGACAGAAGA ... vectơ xử lý Taq polymerase với có m t dTTP Ho t tính tranferase k t thúc chuỗi polymerase xúc t c bổ sung dT vào đầu 3’ – hydroxyl ADN Trộn vectơ T tạo với sản phẩm PCR Taq polymerase xúc t c t ng ... PCR 5’ – GATCGATCGATACGTGATCCTAGCTAGCTACG – 3’ 3’ – CTAGCTAGCTATGCACTAGGATCGATCGATGC – 5’ * Ghép đôi sai mồi Các mồi oligonucleotit dùng cho kỹ thu t PCR phải ghép đôi xác với trình t đích Điều...
- 25
- 1.1K
- 5