laminar flow of two miscible fluids in a simple network
Tài liệu Organic matter distribution of the root zone in a constructed subsuface flow wetland pptx
Ngày tải lên :
24/01/2014, 00:20
...
operation and maintain as well (Watson and Hobson, 1989, Kadlec and Knight, 1996, Mitsch
and Gosselink, 2000). They form one possible promising and feasible approach for a small
scale decentralized ...
distribution in sand bed descending linearly to the flow direction.
2. Materials and methods
Sand sampling was done during January 2007 in the experimental constructed subsurface
flow wetland ...
Abstract
Constructed wetlands are known widely by their characteristic properties like utilization of
natural processes, simple and easy of construction, operation and maintain as well....
- 6
- 473
- 0
Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"
Ngày tải lên :
25/10/2012, 10:45
... quality assurance survey
Natalie Chahine-Malus, Thomas Stewart, Stephen E Lapinsky, Ted Marras, David Dancey,
Richard Leung and Sangeeta Mehta
Mount Sinai Hospital, Toronto, Ontario, Canada
Correspondence: ... Gray et al found that clinicians were
fairly accurate in determining the placement of subclavian or
internal jugular (IJ) vein pulmonary artery (PA) catheter intro-
ducer sheaths, but the clinicians ... CXRs are beneficial to patient care. Brainsky et al
observed that 20% of routine CXRs performed in a medical
ICU had ‘major important’ findings, and 8% prompted a
change in management [4]. The majority...
- 5
- 506
- 0
Báo cáo y học: "Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma"
Ngày tải lên :
26/10/2012, 09:53
... H, Maki H, Takeda Y, et al. Evaluation of combined
nedaplatin and docetaxel therapy for human head and neck
cancer in vivo. Anticancer Res. 2006; 26: 989-94.
16. Yamashita H, Nakagawa K, Tago ... Nakamura
3
, Kazusaburo Kataoka
1
and Toshiyuki Sakaeda
2,3
1. School of Pharmacy and Pharmaceutical Sciences, Mukogawa Women’s University, Nishinomiya, Japan;
2. Graduate School of ... squamous cell carcinoma. J Gastroenterol. 2006; 41:
425-32.
10. Sakaeda T, Yamamori M, Kuwahara A, et al. Pharmacokinetics
and pharmacogenomics in esophageal cancer chemoradio-
therapy. Adv Drug...
- 7
- 531
- 0
Hegel’s Phenomenology of Spirit - post-Kantianism in a newv ein
Ngày tải lên :
01/11/2013, 08:20
... from a lawless will to a certain kind of autonomy is to be taken as
a historical, social achievement, not as the realization of a metaphysical
power that was all along operative in us (as Hegel apparently ... practices must and do play.
Classifying something as a
“concept” or an “intuition,” that is, is already putting it into the place
it plays in the practice of giving and asking for reasons, in ... diminished almost
daily the worth of what was left of his inheritance; and, after the scandal
of involving Schelling and his new wife, Caroline, Schelling traded
his position in Jena for a...
- 29
- 500
- 0
Tài liệu Báo cáo khoa học: Destabilization of psychrotrophic RNase HI in a localized fashion as revealed by mutational and X-ray crystallographic analyses pdf
Ngày tải lên :
18/02/2014, 13:20
... extension: tailor-made genes using the
polymerase chain reaction. Biotechniques 8, 528–535.
34 Kanaya S, Katsuda C, Kimura S, Nakai T, Kitakuni E,
Nakamura H, Katayanagi K, Morikawa K & Ikehara
M ... psychrotrophic RNase HI in a localized
fashion as revealed by mutational and X-ray
crystallographic analyses
Muhammad S. Rohman
1
, Takashi Tadokoro
1
, Clement Angkawidjaja
1
, Yumi Abe
1
,
Hiroyoshi Matsumura
2,3
, ... Gagne
´
M & Rappe
´
AK (1998)
p-Stacking interactions. Alive and well in proteins.
J Biol Chem 273, 15458–15463.
29 Kashiwagi T, Jeanteur D, Haruki M, Katayanagi M,
Kanaya S & Morikawa...
- 11
- 648
- 0
![Tài liệu Báo cáo khoa học: Expression of two [Fe]-hydrogenases in Chlamydomonas reinhardtii under anaerobic conditions doc](https://media.store123doc.com/images/document/14/br/hw/medium_hwm1392870031.jpg)
Tài liệu Báo cáo khoa học: Expression of two [Fe]-hydrogenases in Chlamydomonas reinhardtii under anaerobic conditions doc
Ngày tải lên :
20/02/2014, 11:20
... incubated in sealed glass bottles
under continuous fluorescent light for up to 4 days.
cDNA library screening
Two specic primers, BE5P1 (5Â-AACATCTTCAAGGA
GCGTGGCATC-3Â)andBE3P1(5Â-AGACAGCAGGA
GACTCACAATCAC-3Â), ... and
injected into rabbits to induce antibody generation. The
resulting serum was immunoaffinity purified and tested for
reaction against HydA1 and HydA2 overexpressed in
E. coli and against HydA2 in ... [39]. In
HydA1, the transit peptide is cleaved one amino acid
downstream from the sequence VACAA at position 56 of
the nascent peptide [16]. By analogy, a VXA motif cleavage
site is located at amino...
- 9
- 451
- 0
Báo cáo khoa học: Prediction of missing enzyme genes in a bacterial metabolic network Reconstruction of the lysine-degradation pathway ofPseudomonas aeruginosa doc
Ngày tải lên :
07/03/2014, 09:20
... lysine-
degradation pathway in P. aeruginosa using EC number information. As a
result, we identified PA0266 as a putative 5-aminovalerate aminotransferase
(EC 2.6.1.48) and PA0265 as a putative glutarate ... cloning for
PA0265 were as follows: 5’-GGAATTCCATATGCAACT
CAAAGATGCCAAGCTG)3’ and 5’-CCCAAGCTTGA
TACCGCCCAGGCAGAGGTACTTG-3’.
The primers used for the PCR cloning of PA0266 were
as follows: 5’-GGAATTCCATATGAGCAAGACCAACG
AATCCC-3’ ... pathway:
l-lysine fi 5-amino pentanamide fi 5-amino pen-
tanoate fi glutarate semialdehyde fi glutarate and
l-lysine fi cadaverine fi 1-piperideine fi 5-amino
pentanoate fi glutarate semialdehyde fi glutarate.
The...
- 12
- 441
- 0
Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA 800-521-0600UMI.The Potential of Soil Survey Data in a Quantitative Evaluation of Surficial Geology Mapping in Northern Maine by Rosalia EvansThesis submitted t pptx
Ngày tải lên :
08/03/2014, 23:20
...
identified in the two study areas include stream alluvium, swamp and marsh, glacial-lake
bottom, glacial-lake beach, glacial stream, till, and till over glacial-stream deposits.
Analysis of Genes’s ... Ice-contact depositional features associated with glaciation may contain stratified
till or glaciofluvial sediments. Moraines, kames and kame terraces, kettles, and eskers
are examples of marginal ... of the valley stretching from the
town of Grande Isle to the town of Hamlin. The two areas were delineated as the
research site because they are areas that contain all four of the data sources....
- 131
- 599
- 0
Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot
Ngày tải lên :
08/03/2014, 23:20
... ACCCGG
GTCG
ACTCAGTGATGGTGGTGATGGTGTCCTCGACC
AAAAAGATC; rcpA:forward,GCGATA
GAATTCATG
AGCGTAGAAACGGAAGAC and reverse, CGAAGCTT
GTCGACTCAGTGATGGTGGTGATGGTGCTCCG
ACGGCAATGTCG; cphB:forward,GCGATA
GAATTC
ATG ... cphB:forward,GCGATA
GAATTC
ATG ACGAATTGCGATCGCGA and reverse, ACCCGG
GTCGACTCAGTGATGGTGGTGATGGTGTTTGAC
CTCCTGCAATGT; cphBlong:forward,GCGATA
GAA
TTCATGTTGCAGTTAATTTATAACAATT; the reverse
primer was identical to that used ... cysteine,
thus principally allowing covalent chromophore binding.
Forward primer: 5Â-CACTCGGTACTCCGCAGCGTTT
CGCCGTGTCACATTGAATATTTGCACAATATGG
-3Â; reverse primer: 5Â-CCATATTGTGCAAATATTCAA
TGTGACACGGCGAAACGCTGCGGAGTACCGAG
TG-3Â....
- 10
- 499
- 0
a study on the impact of cost reduction measures in a chieving the competitive advantages in footwear industry
Ngày tải lên :
13/03/2014, 14:20
...
LIST OF ABBREVIATIONS
ASEAN Association of South - East Asian Nation
APEC Asia - Pacific Economic Co-operation
WTO World Trade Organization
AFTA ASEAN Free Trade Area
21
In the ...
knowledge that its primary tasks are recording transaction, keeping financial record,
reporting and analyzing financial information to managers, and sometimes it give some
advices on taxation matters. ... Definition of accounting
In general, accounting is a process of collecting, recording, reporting information.
To go into details, accounting is also considered as a set of practice and body of...
- 62
- 489
- 0
research on awareness and implementation of corporate social responsibility in a multinational company in vietnam case study nestle vietnam
Ngày tải lên :
13/03/2014, 14:20
... business organizations can thereby have an inclusive financial,
commercial and social approach, leading to a long term and strategy minimizing
risks linked to uncertainly.
1.1.3 CSR in multinational ... and as “voluntary disclosures of information,
both qualitative and quantitative made by organizations to inform or influence a
range of audiences. The quantitative disclosures may be financial ... the information needs, this project will use gather both secondary data and
primary data.
3.3.1 Secondary data
The secondary data includes of the information that already exists, having...
- 73
- 705
- 2