lack of integration as a barrier to needed research integration as a prerequisite to research

báo cáo hóa học:" Validity of instruments to measure physical activity may be questionable due to a lack of conceptual frameworks: a systematic review" pot

báo cáo hóa học:" Validity of instruments to measure physical activity may be questionable due to a lack of conceptual frameworks: a systematic review" pot

Ngày tải lên : 20/06/2014, 15:20
... pulmonary disease: a population based cohort study Thorax 2006, 61:772-778 12 Garcia-Aymerich J, Varraso R, Anto JM, Camargo CA Jr: Prospective study of physical activity and risk of asthma exacerbations ... fda.gov/downloads/Drugs/GuidanceComplianceRegulatoryInformation/ Guidances/UCM193282.pdf] American Psychological Association, American Educational Research Association, National Council on Measurement ... may not exactly measure what they claim to measure Furthermore, using a PRO that is not based on a conceptual framework may lead to measurement error (information bias), which is a challenge to...
  • 13
  • 357
  • 0
báo cáo khoa học: " Masculinity as a barrier to men’s use of HIV services in Zimbabwe" potx

báo cáo khoa học: " Masculinity as a barrier to men’s use of HIV services in Zimbabwe" potx

Ngày tải lên : 11/08/2014, 14:21
... physically strong and capable of withstanding disease Men are perceived as emotionally independent and tough Men should not show fear Characteristics of a real man’ Social constructions of masculinity ... extra-marital sexual relationships and gets an embarrassing disease like HIV is perceived to have a weak, diseased, compromised, laughable and despicable sexuality - compromising his manhood Relatedly, ... trust often served as a strategy to give men the push they needed to make use of HIV services “My wife was worried and was always asking about my health The swellings were not painful to me at all,...
  • 14
  • 603
  • 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Ngày tải lên : 23/03/2014, 05:22
... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... MAP band was observed (not shown) Gene and mRNA analyses of MAP1b, MAP2, Tau, and STOP The finding that apparently normal neurites are formed even when CAD cells lack MAP1b, MAP2, Tau, and STOP...
  • 14
  • 416
  • 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Ngày tải lên : 23/03/2014, 07:20
... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... kinase-5 (ERK5) mitogen-activated protein (MAP) kinase [18] GR assays indicated that human Hsp9 0a and Hsp90b, as well as the native yeast Hsp90s, were all capable of activating GR in these strains ... tryptophan Automated measurement of the b-galactosidase activity due to basal and stress-induced expression of the interaction-responsive, GAL7 promoterregulated LacZ gene of PJ69-4 was as previously...
  • 11
  • 427
  • 0
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot

Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot

Ngày tải lên : 30/03/2014, 15:20
... Esposito and I Caputo 132 Akagi A, Tajima S, Ishibashi A, Matsubara Y, Takehana M, Kobayashi S & Yamaguchi, N (2002) Type XVI collagen is expressed in factor XIIIa+ monocyte-derived dermal dendrocytes ... Transglutaminasecatalyzed inactivation of glyceraldehydes 3-phosphate dehydrogenase and a- ketoglutarate dehydrogenase complex by polyglutamine domains of pathological length Proc Natl Acad Sci USA 94, ... Analysis of transglutaminase protein substrates by functional proteomics Protein Sci 12, 1290–1297 Facchiano AM, Facchiano A & Facchiano F (2003) Active sequences collection (ASC) database: a...
  • 17
  • 440
  • 0
a study of the market's reaction to superior sustainability reporting as demonstrated by the financial performance of publicly traded companies

a study of the market's reaction to superior sustainability reporting as demonstrated by the financial performance of publicly traded companies

Ngày tải lên : 03/06/2014, 00:48
... Sustainability was considered as a manifestation of ethical leadership due to the fact that both sustainability and ethical leadership emphasize transparency of operations, balancing long-term value with ... based upon the information available For this reason, information availability and transparency is very important, if all market participants not have equal access to information price variances ... practices that increase value If sustainability reporting is embraced as a standard business reporting practice, additional information is made available to the marketplace to potentially facilitate...
  • 145
  • 431
  • 0
báo cáo hóa học: " Integration of immigrants into a new culture is related to poor sleep quality" pptx

báo cáo hóa học: " Integration of immigrants into a new culture is related to poor sleep quality" pptx

Ngày tải lên : 18/06/2014, 19:20
... translated into Portuguese by professional translators and translated back into German by the accompanying translators The interview was identical to the one given to the Moroccan women Internal ... four pertaining to a monitoring and four to a blunting, i.e distracting style of coping Participants are asked to anticipate each scenario and rate how likely they would engage in each of the eight ... actual coping style It may also be that anxiety was a moderating factor in this sample Future studies should, therefore, assess social desirability and anxiety The overall percentage of monitors...
  • 6
  • 435
  • 0
báo cáo hóa học: " Sense of coherence as a resource in relation to health-related quality of life among mentally intact nursing home residents – a questionnaire study" pot

báo cáo hóa học: " Sense of coherence as a resource in relation to health-related quality of life among mentally intact nursing home residents – a questionnaire study" pot

Ngày tải lên : 18/06/2014, 19:20
... for activities such as occupational therapy and participation in the political, cultural and religious arenas In this way, health care professionals can encourage the residents to engage in activities ... manuscript and read and approved the final manuscript Additional material Additional file Analysis of covariance of each subscale of SF-36 (n = 227) with respect to SOC adjusted for sex, age group, marital ... inclusion criteria Beyond that, the participation rate was high (90%) Dementia was not diagnosed as part of this study To reach the target population, we took a rather pragmatic position when...
  • 9
  • 844
  • 0
n order to better illustrate the necessary functions and features of this application, a rainwater retention basin is assumed as example

n order to better illustrate the necessary functions and features of this application, a rainwater retention basin is assumed as example

Ngày tải lên : 01/07/2014, 21:04
... Library for STEP Basic V11 Containing also the outdated library based on STEP V10.5 CE-X25_S7-1200_SM S_library.zip Configuration Example X25 (Documentation based on the Startup-Code) ConfigurationExampl ... sem WatchDog” (www.plcsemwatchdog.blogspot.com) Um PLC sem Watchdog [006] - Programas demo PLC S7-1200 da SIEMENS (Simatic) Filter criteria: Hardware platform : SIMATIC S7-1200, SINAUT Software ... 25545680 Latest modification Startup-Code and library with the actual version counter V1.2 and the append ant documentations is now adapted to STEP V11 Additional search terms wireless, m2m, without...
  • 3
  • 300
  • 0
báo cáo khoa học: "Acute abdomen due to spontaneous splenic rupture as the first presentation of lung malignancy: a case report" ppsx

báo cáo khoa học: "Acute abdomen due to spontaneous splenic rupture as the first presentation of lung malignancy: a case report" ppsx

Ngày tải lên : 10/08/2014, 23:20
... Sugahara K, Togashi H, Aoki M, Mitsuhashi H, Matsuo T, Watanabe H, Abe T, Ohno S, Saito K, Saito T, Shinzawa H, Tanida H, Ito M, Takahashi T: Spontaneous splenic rupture in a patient with large ... with associated significant mediastinal adenopathy and a cm upper right paratracheal node Pneumococcal and meningococcal vaccines were administered and our patient was then promptly taken to theater ... approximately 40 pack years and had unlimited exercise tolerance She worked as a nurse and there was no history of previous exposure to asbestos or other occupational hazards Page of On examination...
  • 4
  • 347
  • 0
báo cáo khoa học: " Intestinal adhesion due to previous uterine surgery as a risk factor for delayed diagnosis of uterine rupture: a case report" pot

báo cáo khoa học: " Intestinal adhesion due to previous uterine surgery as a risk factor for delayed diagnosis of uterine rupture: a case report" pot

Ngày tải lên : 10/08/2014, 23:20
... cesarean: a case series and review of the literature Am J Perinatol 2009, 26(10):739-744 Kurdoglu M, Kolusari A, Yildizhan R, Adali E, Sahin HG: Delayed diagnosis of an atypical rupture of an ... Cite this article as: Kuwata et al.: Intestinal adhesion due to previous uterine surgery as a risk factor for delayed diagnosis of uterine rupture: a case report Journal of Medical Case Reports ... Kuwata et al Journal of Medical Case Reports 2011, 5:523 http://www.jmedicalcasereports.com/content/5/1/523 made Slight abdominal pain continued with stable vital signs and unremarkable laboratory...
  • 3
  • 328
  • 0
Báo cáo y học: " Cystitis due to the use of ketamine as a recreational drug: a case report" pot

Báo cáo y học: " Cystitis due to the use of ketamine as a recreational drug: a case report" pot

Ngày tải lên : 11/08/2014, 21:22
... analysis and urine cytology were negative and a urine culture was sterile An ultrasound examination revealed a thickened bladder wall and a small bladder capacity but normal kidneys Cystoscopy ... from cessation of ketamine use In one case the addition of pentosane polysulphate appeared to provide some symptomatic relief In our case cystoscopy showed only mild signs of inflammation and biopsies ... irritation Conclusion As ketamine is being used increasingly as a recreational drug we expect ketamine-associated cystitis to become more prevalent in young adults Health care workers should be aware...
  • 3
  • 391
  • 0
Báo cáo y học: " Lack of replication of genetic predictors for the rheumatoid arthritis response to anti-TNF treatments: a prospective case-only study" potx

Báo cáo y học: " Lack of replication of genetic predictors for the rheumatoid arthritis response to anti-TNF treatments: a prospective case-only study" potx

Ngày tải lên : 12/08/2014, 12:20
... is calculated as follows: relDAS28 = ⎡ ( DAS28 at baseline - DAS28 at months ) / DAS28 at baseline ⎤ × 100 ⎣ ⎦ Page of A secondary outcome was the European League Against Rheumatism (EULAR) response ... peptide) antibodies, and higher baseline HAQ and DAS28 levels There were 70.2% of patients with high disease activity at baseline as assessed by a DAS28 of greater than 5.1 In spite of this high activity, ... DAS28 [12] The primary outcome was the quantitative variable relDAS28, which is the relative change in DAS28 between baseline and the time of evaluation Presented as a percentage, this variable...
  • 6
  • 280
  • 0
Báo cáo y học: "Lack of neo-sensitization to Pen a 1 in patients treated with mite sublingual immunotherapy" pps

Báo cáo y học: "Lack of neo-sensitization to Pen a 1 in patients treated with mite sublingual immunotherapy" pps

Ngày tải lên : 13/08/2014, 13:22
... presence of a case history consistent with mite allergy, that is symptoms of persistent rhinoconjuntivitis and/or mild to moderate asthma for at least years In addition they had to have a positive ... GWC analysed the results and participated to writing the manuscript All authors read and approved the final manuscript Page of Author Details 1Allergy Unit, National Health Service, Rete di Allergologia ... Italy, 4Research and Development, Stallergènes SA, Antony, France, 5Medical and Scientific Department, Stallergenes, Milan, Italy, 6Allergy and Respiratory Diseases DIMI, University of Genoa...
  • 4
  • 248
  • 0
Báo cáo y học: "Cost-effectiveness of micafungin as an alternative to fluconazole empiric treatment of suspected ICU-acquired candidemia among patients with sepsis: a model simulatio" ppsx

Báo cáo y học: "Cost-effectiveness of micafungin as an alternative to fluconazole empiric treatment of suspected ICU-acquired candidemia among patients with sepsis: a model simulatio" ppsx

Ngày tải lên : 13/08/2014, 16:21
... manufacturer of micafungin MDZ and AFS are consultants to and SK is an employee of Astellas SK is a stock holder in Astellas Pharma US, Inc, the manufacturer of micafungin AFS and MDZ have received ... locally among any CG isolates, a clinician may be forced to generalize that all non-albicans species be treated as if they were FLU resistant Similarly, in the case of non-availability of data ... loading dose on day 1, while MIC was assumed to be given at 100 mg intravenously daily In the base case a three-day lag period between the onset of ICUAC and the availability of C&S results was...
  • 11
  • 254
  • 0
Cultural Differences A Barrier to Native English Teachers in English as a Foreign Language Context

Cultural Differences A Barrier to Native English Teachers in English as a Foreign Language Context

Ngày tải lên : 24/06/2015, 08:16
... learners to use the target language in appropriate ways to convey meanings, CLT is unsuitable for Asian learners because this approach would not help them to pass the traditional national examinations, ... questions of clarification as a means of showing disapproval, and perhaps also of implying that there is confrontation between co-participants (LoCastro [14]), it is understandable that Japanese ... respect to the Japanese: A guide for Americans InterAct series Yarmouth, Me: Intercultural Press, 1984 [15] V LoCastro, Intercultural pragmatics A JapaneseAmerican case study Lancaster [England]:...
  • 10
  • 544
  • 0
current situation of outsourcing development, a number of favorable factors promoting this industry as well as analysis of outsourcing activities FPT Software.doc

current situation of outsourcing development, a number of favorable factors promoting this industry as well as analysis of outsourcing activities FPT Software.doc

Ngày tải lên : 27/10/2012, 16:41
... : Japanese levels of proficiency or experience LAN : Local Area Network NASDAQ : National Association of Securities Dealers Automated Quotation System NASSCOM : National Association of Software ... historical legacy that has created a greater awareness of French and English than many East Asian rivals Young Vietnamese with better English communication have already overcome the language barrier ... Telematics, together with the Vietnam Software Association (VINASA), has taken steps to increase quality standards for the industry Vietnam is rapidly emerging as one of the top choices for Japanese...
  • 79
  • 611
  • 6
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

Ngày tải lên : 10/04/2013, 14:46
... central concern of applied linguistic As a matter of fact, C .A has had much to offer not only to practical language but also to translation theory, the description of particular language, language ... should be washed everyday Nguyễn Thị Nga K 1 1A 19 Graduation paper 2.2.5 Exclamatory adjective sentence An adjective as head of an adjective phrase or as its sole realization can be an exclamation: ... up to now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central...
  • 44
  • 1.7K
  • 7
The Potential of Biofumigants as Alternatives to Methyl Bromide for the Control of Pest Infestation in Grain and Dry Food Products

The Potential of Biofumigants as Alternatives to Methyl Bromide for the Control of Pest Infestation in Grain and Dry Food Products

Ngày tải lên : 25/10/2013, 05:20
... Rosmarinus of cinalis Ruta chalepensis Salvia dominica Salvia fruticosa Salvia of cinalis Salvia sclarea Satureja thymbra Thymus vulgaris Geraniaceae Apiaceae Apiaceae Lamiaceae Rutaceae Lamiaceae ... Family Species Family Apium graveolens Artemisia arborescens A judaica Carum carvi Apiaceae Compositae Compositae Apiaceae Lamiaceae Lamiaceae Lamiaceae Lamiaceae Citrus limonum Rutaceae Coriandrum ... Poaceae Apiaceae Lauraceae Lamiaceae Lamiaceae Asteraceae Lamiaceae Lamiaceae Micromeria fruticosa O basilicum O gratissimum Origanum vulgare Pelargonium graveoleus Petroselinum crispum Pimpinella anisum...
  • 20
  • 483
  • 0

Xem thêm