key competencies of a sales manager
Family Life, Reproductive Health, and Population Education: Key Elements of a Health-Promoting School docx
Ngày tải lên :
22/03/2014, 12:20
... conducting a situation analysis. It is important to make the analysis
manageable and practical so that activities can proceed quickly to the action planning and
implementation stage. Too many projects ... 1993).
Boys are also at risk of infection and causing unwanted pregnancy. Studies in
Africa, Asia, and Latin America showed that 25–27% of young men had multiple
partners in the past year, thus ... context of the target audience.
The situation analysis may involve gathering qualitative data including anecdotal informa-
tion, and quantitative (numeric) data on needs and resources inside and...
- 90
- 469
- 0
Effective Sales Management Techniques - A Few Important Steps can keep a Sales Manager Focused and His or Her Team Accountable doc
Ngày tải lên :
30/03/2014, 12:21
... Each of
which has a direct affect on the success of the organization.
The sales manager is frequently an active salesperson, as well as an administrator.
He or she must make sure quotas are ... times.
1
Effective Sales Management Techniques
A Few Important Steps can keep a Sales Manager Focused and His
or Her Team Accountable
The position of sales manager often comes with multiple ... the state of the market, lack of
leads and referrals, inability to get to the decision maker, etc. is usually better at
making excuses than making sales.
The quandary for the sales manager...
- 6
- 497
- 1
The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company
Ngày tải lên :
18/04/2013, 08:57
... parties are
familiar with available insurance policies, but it is too strict and necessary for an
international transaction. Unless parties are assured that the coverage is available in
the amount ... contract serves as a
guide and a memorial of the agreement that must be followed by both parties.
2.1.2.2. Characteristics of foreign sales contract
Basically, a foreign sales contract shares ... in an
amicable way. If the parties fail to read an agreement in such way, the dispute shall be brought to the Central of
the International Arbitration under Chamber of Commerce and industry of...
- 41
- 615
- 0
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx
Ngày tải lên :
24/12/2013, 01:17
... DataTable. This is the default.
None Indicates that no action takes place.
SetDefault Indicates that the DataColumn values in the child DataTable are to be set
to the value in the DefaultValue ... J6COM. A copy of
this row is stored in a DataTable named customersDT.
•
There is a row in the Orders table that also has a CustomerID of J6COM. A copy
of this row is stored in a DataTable named ... change the DataColumn in
the parent DataTable on which the ForeignKeyConstraint was created, then the same
change is also made in any corresponding DataRow objects in the child DataTable. You
should...
- 6
- 428
- 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
Ngày tải lên :
20/02/2014, 01:20
... Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC
3 Department of Biochemistry, University of Minnesota College of Biological Sciences, St Paul, MN, USA
Staphylococcal nuclease (SNase) is a ... folding pathway: structure-based analysis of
staphylococcal nuclease. Proteins: Structure, Function
and Genetics 27, 171–183.
15 Flanagan JM, Kataoka M, Fujisawa T & Engelman
DM (1993) Mutations ... Salmon testes
DNA and some analytical grade chemicals such as EDTA,
Tris ⁄ HCl, CaCl
2
, NaCl and mineral oil were obtained from
Sigma (St Louis, MO, USA). Salmon testes DNA for the
enzyme activity...
- 7
- 551
- 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
Ngày tải lên :
06/03/2014, 01:20
... and 5¢-AUAAGUAAUUUCUACGACG
dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd
TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢
(siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢
and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ (siNup-
358-2)]. ... 5¢-AGCTTATCCTCGTTACAATCAA
GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG
A- 3¢) were annealed and inserted into the BglII and HindIII
sites of pEGFP-NLS. The oligonucleotide fragment for
NES-NLS was flanked ... dystrophy, cardiomyopathy and
Dunnigan-type partial lipodystrophy. J Cell Sci 114,
4435–4445.
13 Maeshima K, Yahata K, Sasaki Y, Nakatomi R,
Tachibana T, Hashikawa T, Imamoto F & Imamoto
N (2006)...
- 12
- 454
- 0
Components of Software Development Risk: How to Address Them? A Project Manager Survey ppt
Ngày tải lên :
07/03/2014, 00:20
... proponents of software risk
management, information about the impact of software risk
management has been sparse and anecdotal. There are only
a few empirical studies about the commonality and type of
software ... identification of risks that are often organizationally
sensitive. It demands more courage to air such risks if
organizationally accepted risk management procedures are
not available.
Interestingly, managers ... resource usage and deadline effect. The other items
loading to this factor are: evaluation of performance require-
ments, managing project complexity, and estimation of
hardware and software capabilities....
- 15
- 665
- 0
Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt
Ngày tải lên :
08/03/2014, 02:20
... of substrate activation of pyruvate decarboxylase: a
first approach. Eur. J. Biochem. 92, 175–181.
36. Rivoal, J., Ricard, B. & Pradet, A. (1990) Purification and partial
characterization of ... EcIPDC, a discontinuous
assay based on HPLC was used [7]. To analyse the kinetic
behaviour of the enzyme in more detail, a coupled optical
assay was elaborated with alcohol dehydrogenase as
auxiliary ... large amounts of indole-3-acetic acid.
Indolepyruvate decarboxylase, the key enzyme in the
biosynthetic pathway of indole-3-acetic acid, catalyses the
formation of indole-3-acetaldehyde and carbon...
- 10
- 430
- 0
Guidance on the teaching of writing skills INSET opportunities for teachers of a subjects across the curriculum at Key Stages 2 and 3 docx
Ngày tải lên :
10/03/2014, 05:20
... full advantage of this fact. There is a
significant body of research evidence to show that learners who speak more
than one language have an increased ability to use and learn language in
general. ... Welsh language coordinator of a primary or special
school and/or the appropriate head(s) of department in a secondary
school, a member of the school’s senior management team (SMT) or
the LA advisory ... content of the writing of many learners of all abilities is often marred by
inaccuracies in spelling, punctuation and grammar.
• Less-able learners often make slow progress in their learning because...
- 174
- 616
- 0
Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx
Ngày tải lên :
15/03/2014, 10:20
... of untreated Avicel.
Multivariate statistical analysis of X-ray data
The CrI of cellulose samples was also calculated by quanti-
fying the contribution of amorphous cellulose (PASC) and
Avicel ... shown are the average of quadrupli-
cates.
Fig. 5. Effect of crystallinity (obtained from X-ray diffraction data and
multivariate statistical analysis) on the initial rate in Avicel enzymatic
hydrolysis ... carbon signals in
NMR analysis could be obtained below a certain
degree of crystallinity and within a reasonable acquisi-
tion time, so that X-ray diffraction was used as an
alternative to map...
- 12
- 554
- 0
Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt
Ngày tải lên :
17/03/2014, 10:20
... 5¢-CATTGTTGAAGACATCAATGTTG-3¢ 5¢-CAACATTGATGTCTTCAACAATG-3¢ 43
N302F 5¢-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3¢ 5¢-GCTGCAACATTGATGAATTCAACAATGTAAAG-3¢ 43
I30 3A 5¢-CATTGTTGAAAACGCTAATGTTGCAG-3¢ 5¢-CTGCAACATTAGCGTTTTCAACAATG-3¢ ... 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢ 55
R103E 5¢-GAACACAACATTCTCTGTTCTCGAACC-3¢ 5¢-GGTTCGAGAACAGAGAATGTTGTGTTC-3¢ 55
DKR 5¢-GAAGTTAAAGATACAATGATTCAGCTC 5¢-GAGCTGAATCATTGTAACTTTAACTTC-3¢ 48
N302D 5¢-CATTGTTGAAGACATCAATGTTG-3¢ ... triple mutants.
Mutant Sense Primer Antisense Primer T
m
R101M 5¢-GAGTTTGGTTCGATGACAAGGAATGTTG-3¢ 5¢-CAACATTCCTTGTCATCGAACCAAACTC-3¢ 58
R103M 5¢-GTTCGAGAACAATGAATGTTGTGTTC-3¢ 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢...
- 12
- 380
- 0
Báo cáo khoa học: The crystal structure of a xyloglucan-specific endo-b-1,4glucanase from Geotrichum sp. M128 xyloglucanase reveals a key amino acid residue for substrate specificity potx
Ngày tải lên :
23/03/2014, 05:22
... Biological Resources and Functions, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Ibaraki,
Japan
2 Research Institute of Genome-based Biofactory, National Institute ... at both ends. In the case of
Xgh7 4A, the active cleft is open. Although a precise anal-
ysis of the mode of action of Xgh7 4A has not been
performed, Xgh7 4A appears to be an endoglucanase
because ... Prism (GraphPad Software, San Diego,
CA, USA). One unit was defined as the amount of enzyme
that released 1 lmol of glucose equivalent as reducing sug-
ars from xyloglucan per minute.
Analysis of substrate...
- 7
- 361
- 0
Báo cáo khoa học: Calpain 3: a key regulator of the sarcomere? pot
Ngày tải lên :
23/03/2014, 10:21
... motifs. Arch Biochem
Biophys 342, 99–107.
22 Sorimachi H, Kinbara K, Kimura S, Takahashi M, Ishi-
ura S, Sasagawa N, Sorimachi N, Shimada H, Tagawa
K, Maruyama K, et al. (1995) Muscle-specific calpain,
p94, ... Sorimachi H, Toyama-Sorimachi N, Saido TC,
Kawasaki H, Sugita H, Miyasaka M, Arahata K,
Ishiura S & Suzuki K (1993) Muscle-specific calpain,
p94, is degraded by autolysis immediately after transla-
tion, ... Kawamura Y,
Kanzawa N, Nakauchi Y, Kimura S, Kawashima S &
Maruyama K (1993) A novel domain sequence of
connectin localized at the I band of skeletal muscle
sarcomeres: homology to neurofilament...
- 10
- 350
- 0
Báo cáo Y học: Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids pot
Ngày tải lên :
24/03/2014, 03:21
... (5¢-GGAGGGTGGCAGCATGTCGTTCCTTGG
GG-3¢,forward),GSP 5a( 5¢-GTGGCTTCTTGAGTCAT
AGAATCGTGGATGAC-3¢, reverse) and GSP5b (5¢-GT
GCATACAACGAAGGCAATCGAGGTCC-3¢, reverse)
using Marathon
TM
cDNA Amplification ... & Hughes, M .A. (1994) Investigation of
theactivesiteofthecyanogenicb-
D
-glucosidase (linamarase) from
Manihot esculenta Crantz (cassava). II. Identification of Glu-198
as an active site carboxylate ... was
extracted with an equal volume of EtOAc, pH of the water
phase adjusted to 8.0 with 25% ammonia and extraction
with equal volume of EtOAc repeated. The organic phases
were evaporated and chromatographed...
- 10
- 650
- 0
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot
Ngày tải lên :
30/03/2014, 04:20
... 728–733.
72 Hayakawa M, Miyashita H, Sakamoto I, Kitagawa M,
Tanaka H, Yasuda H, Karin M & Kikugawa K (2003)
Evidence that reactive oxygen species do not mediate
NF-kappaB activation. EMBO ... vas-
cular endothelial growth factor stress response
increases the antitumor effects of ionizing radiation.
Cancer Res 59, 3374–3378.
101 Kanaan A, Farahani R, Douglas RM, Lamanna JC &
Haddad ... enzymes that lead to extracellular matrix degra-
dation (matrix metalloproteases) [75–78]. In addition,
NF-jB activation was reported as an early event in
malignant transformation in vitro [79], and...
- 12
- 390
- 0
