key competencies of a project manager
Components of Software Development Risk: How to Address Them? A Project Manager Survey ppt
Ngày tải lên :
07/03/2014, 00:20
... proponents of software risk
management, information about the impact of software risk
management has been sparse and anecdotal. There are only
a few empirical studies about the commonality and type of
software ... bosses denote those of a project manager.
regression analysis. PCA analyzes the covariation of a set of
variables and condenses the variation into a smaller number
of underlying (latent) components. ... resource usage and deadline effect. The other items
loading to this factor are: evaluation of performance require-
ments, managing project complexity, and estimation of
hardware and software capabilities....
- 15
- 665
- 0
Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx
Ngày tải lên :
15/01/2014, 15:59
... is capable of giving a solid explanation of what has happened and why
as well as provide a solution that will correct the situation, a considerable positive impact
towards the satisfaction of ... expectations and
the performance of the organization’s offerings (see e.g. Parasuraman et al., 1985 & 1988 &
1991). Another stream of research is the performance-based approach (or linear ... between projects is organized as a part of the quality management system of
the supplier organization. Individual project managers are focused on successful project
completion may have only a little...
- 37
- 1.1K
- 0
Family Life, Reproductive Health, and Population Education: Key Elements of a Health-Promoting School docx
Ngày tải lên :
22/03/2014, 12:20
... Health Team and
Community Advisory Committee are established, members can start the planning
process by conducting a situation analysis. It is important to make the analysis
manageable and practical ... results of the analysis also serve as
baseline data for subsequent evaluations.
Situation analysis on the national, district, and/or local level is important for
several reasons:
ã Policy- and decision-makers ... qualitative data including anecdotal informa-
tion, and quantitative (numeric) data on needs and resources inside and outside of school
that will be used for planning interventions and as a baseline...
- 90
- 469
- 0
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx
Ngày tải lên :
24/12/2013, 01:17
... DataTable. This is the default.
None Indicates that no action takes place.
SetDefault Indicates that the DataColumn values in the child DataTable are to be set
to the value in the DefaultValue ... J6COM. A copy of
this row is stored in a DataTable named customersDT.
ã
There is a row in the Orders table that also has a CustomerID of J6COM. A copy
of this row is stored in a DataTable named ... change the DataColumn in
the parent DataTable on which the ForeignKeyConstraint was created, then the same
change is also made in any corresponding DataRow objects in the child DataTable. You
should...
- 6
- 428
- 0
Tài liệu Improving Child Health in Cambodia: Social Marketing of Diarrhea Treatment Kit, Results of a Pilot Project pdf
Ngày tải lên :
12/02/2014, 19:20
... critical in
urban and peri-urban areas where caregiv-
ers have more access to financial means and
greater availability of alternative treatments.
Lesson 4: The availability of anti-diarheal products ... in rural areas of Siem Reap and
Pursat. The partnerships also facilitated
an extensive training program of partners
and providers on diarrheal disease, pre-
vention, and treatment, and the ... 12
www.casesjournal.org
To increase acceptability of the product,
messages also emphasized the fact that the
Orasel tasted better than the available ORS
and that the zinc had a sweet taste.
Village...
- 19
- 438
- 1
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
Ngày tải lên :
20/02/2014, 01:20
... Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC
3 Department of Biochemistry, University of Minnesota College of Biological Sciences, St Paul, MN, USA
Staphylococcal nuclease (SNase) is a ... folding pathway: structure-based analysis of
staphylococcal nuclease. Proteins: Structure, Function
and Genetics 27, 171–183.
15 Flanagan JM, Kataoka M, Fujisawa T & Engelman
DM (1993) Mutations ... Salmon testes
DNA and some analytical grade chemicals such as EDTA,
Tris ⁄ HCl, CaCl
2
, NaCl and mineral oil were obtained from
Sigma (St Louis, MO, USA). Salmon testes DNA for the
enzyme activity...
- 7
- 551
- 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
Ngày tải lên :
06/03/2014, 01:20
... and 5Â-AUAAGUAAUUUCUACGACG
dTdT-3Â; Nup358, 5Â-CCAGUCACUUACAAUUAAAd
TdT-3Â and 5Â-UUUAAUUGUAAGUGACUGGdTdT-3Â
(siNup358-1), 5Â-UGAAGCACAUGCUAUAAAAdTdT-3Â
and 5Â-UUUUAUAGCAUGUGCUUCAdTdT-3Â (siNup-
358-2)]. ... 5Â-AGCTTATCCTCGTTACAATCAA
GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG
A- 3Â) were annealed and inserted into the BglII and HindIII
sites of pEGFP-NLS. The oligonucleotide fragment for
NES-NLS was flanked ... dystrophy, cardiomyopathy and
Dunnigan-type partial lipodystrophy. J Cell Sci 114,
4435–4445.
13 Maeshima K, Yahata K, Sasaki Y, Nakatomi R,
Tachibana T, Hashikawa T, Imamoto F & Imamoto
N (2006)...
- 12
- 454
- 0
Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt
Ngày tải lên :
08/03/2014, 02:20
... substrate activation of pyruvate decarboxylase: a
first approach. Eur. J. Biochem. 92, 175–181.
36. Rivoal, J., Ricard, B. & Pradet, A. (1990) Purification and partial
characterization of pyruvate ... large amounts of indole-3-acetic acid.
Indolepyruvate decarboxylase, the key enzyme in the
biosynthetic pathway of indole-3-acetic acid, catalyses the
formation of indole-3-acetaldehyde and carbon ... m
M
ammonium
sulphate. EcIPDC was eluted with the same buffer at a ow
rate of 1 mLặmin
)1
at 8 C and detected by the protein
absorbance at 280 nm. Ferritin (450 kDa), catalase
(240 kDa), BSA (68 kDa), and ovalbumin...
- 10
- 430
- 0
Guidance on the teaching of writing skills INSET opportunities for teachers of a subjects across the curriculum at Key Stages 2 and 3 docx
Ngày tải lên :
10/03/2014, 05:20
... full advantage of this fact. There is a
significant body of research evidence to show that learners who speak more
than one language have an increased ability to use and learn language in
general. ... Welsh language coordinator of a primary or special
school and/or the appropriate head(s) of department in a secondary
school, a member of the school’s senior management team (SMT) or
the LA advisory ... content of the writing of many learners of all abilities is often marred by
inaccuracies in spelling, punctuation and grammar.
ã Less-able learners often make slow progress in their learning because...
- 174
- 616
- 0
The Project Gutenberg EBook of A First Book in Algebra, pot
Ngày tải lên :
15/03/2014, 00:20
... twice
that of a book. What was the cost of each?
5. George bought an equal number of apples, oranges, and bananas for $1.08;
each apple cost 2 cents, each orange 4 cents, and each banana 3 cents. ... subtracted
from 5a to obtain 2a? 5a − 3a =?
What must be added to − 3a to obtain 4a? What then must be subtracted
from 4a to obtain − 3a? 4a − 7a =?
What must be added to 3a to obtain − 2a? What then must ... he would have just as many as John. How many has each?
6. In a storehouse containing 57 barrels there are 3 less barrels of flour than
of meal. How many of each?
7. A man whose herd of cows numbered...
- 189
- 432
- 0
Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx
Ngày tải lên :
15/03/2014, 10:20
... of untreated Avicel.
Multivariate statistical analysis of X-ray data
The CrI of cellulose samples was also calculated by quanti-
fying the contribution of amorphous cellulose (PASC) and
Avicel ... shown are the average of quadrupli-
cates.
Fig. 5. Effect of crystallinity (obtained from X-ray diffraction data and
multivariate statistical analysis) on the initial rate in Avicel enzymatic
hydrolysis ... carbon signals in
NMR analysis could be obtained below a certain
degree of crystallinity and within a reasonable acquisi-
tion time, so that X-ray diffraction was used as an
alternative to map...
- 12
- 554
- 0
Hygeia, a City of Health, by Benjamin Ward Richardson This eBook give it away or re-use it under the terms of the Project Gutenb doc
Ngày tải lên :
15/03/2014, 15:20
... there are areas, and
kitchens, and servants' offices, there are
here subways through which the air
flows freely, and down the inclines of
which all currents of water are carried
away.
The acreage ... I
should ask of the past what hope there is
of any such advancement of human
progress. For, as my Lord of Verulam
quaintly teaches, 'the past ever deserves
that men should stand upon it for awhile
to ... the advantage to
those who have to live; that one good
thought leading to practical useful action
from one man or woman, may go to the
virtue of thousands of generations; that
one breath of health...
- 116
- 376
- 0
Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt
Ngày tải lên :
17/03/2014, 10:20
... 5Â-CATTGTTGAAGACATCAATGTTG-3Â 5Â-CAACATTGATGTCTTCAACAATG-3Â 43
N302F 5Â-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3Â 5Â-GCTGCAACATTGATGAATTCAACAATGTAAAG-3Â 43
I30 3A 5Â-CATTGTTGAAAACGCTAATGTTGCAG-3Â 5Â-CTGCAACATTAGCGTTTTCAACAATG-3Â ... 5Â-GAACACAACATTCATTGTTCTCGAAC-3Â 55
R103E 5Â-GAACACAACATTCTCTGTTCTCGAACC-3Â 5Â-GGTTCGAGAACAGAGAATGTTGTGTTC-3Â 55
DKR 5Â-GAAGTTAAAGATACAATGATTCAGCTC 5Â-GAGCTGAATCATTGTAACTTTAACTTC-3Â 48
N302D 5Â-CATTGTTGAAGACATCAATGTTG-3Â ... triple mutants.
Mutant Sense Primer Antisense Primer T
m
R101M 5Â-GAGTTTGGTTCGATGACAAGGAATGTTG-3Â 5Â-CAACATTCCTTGTCATCGAACCAAACTC-3Â 58
R103M 5Â-GTTCGAGAACAATGAATGTTGTGTTC-3Â 5Â-GAACACAACATTCATTGTTCTCGAAC-3Â...
- 12
- 380
- 0
Báo cáo khoa học: The crystal structure of a xyloglucan-specific endo-b-1,4glucanase from Geotrichum sp. M128 xyloglucanase reveals a key amino acid residue for substrate specificity potx
Ngày tải lên :
23/03/2014, 05:22
... Biological Resources and Functions, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Ibaraki,
Japan
2 Research Institute of Genome-based Biofactory, National Institute ... at both ends. In the case of
Xgh7 4A, the active cleft is open. Although a precise anal-
ysis of the mode of action of Xgh7 4A has not been
performed, Xgh7 4A appears to be an endoglucanase
because ... Computational Project N (1994) The
CCP4 suite: programs for protein crystallography. Acta
Crystallogr D 50, 760–763.
18 Navaza J (1994) AMoRe: an automated package for
molecular replacement. Acta Crystallogr...
- 7
- 361
- 0
Báo cáo khoa học: Calpain 3: a key regulator of the sarcomere? pot
Ngày tải lên :
23/03/2014, 10:21
... motifs. Arch Biochem
Biophys 342, 99–107.
22 Sorimachi H, Kinbara K, Kimura S, Takahashi M, Ishi-
ura S, Sasagawa N, Sorimachi N, Shimada H, Tagawa
K, Maruyama K, et al. (1995) Muscle-specific calpain,
p94, ... Sorimachi H, Toyama-Sorimachi N, Saido TC,
Kawasaki H, Sugita H, Miyasaka M, Arahata K,
Ishiura S & Suzuki K (1993) Muscle-specific calpain,
p94, is degraded by autolysis immediately after transla-
tion, ... Kawamura Y,
Kanzawa N, Nakauchi Y, Kimura S, Kawashima S &
Maruyama K (1993) A novel domain sequence of
connectin localized at the I band of skeletal muscle
sarcomeres: homology to neurofilament...
- 10
- 350
- 0
