key competencies of a manager
Family Life, Reproductive Health, and Population Education: Key Elements of a Health-Promoting School docx
Ngày tải lên :
22/03/2014, 12:20
... conducting a situation analysis. It is important to make the analysis
manageable and practical so that activities can proceed quickly to the action planning and
implementation stage. Too many projects ... 1993).
Boys are also at risk of infection and causing unwanted pregnancy. Studies in
Africa, Asia, and Latin America showed that 25–27% of young men had multiple
partners in the past year, thus ... context of the target audience.
The situation analysis may involve gathering qualitative data including anecdotal informa-
tion, and quantitative (numeric) data on needs and resources inside and...
- 90
- 469
- 0
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx
Ngày tải lên :
24/12/2013, 01:17
... DataTable. This is the default.
None Indicates that no action takes place.
SetDefault Indicates that the DataColumn values in the child DataTable are to be set
to the value in the DefaultValue ... J6COM. A copy of
this row is stored in a DataTable named customersDT.
•
There is a row in the Orders table that also has a CustomerID of J6COM. A copy
of this row is stored in a DataTable named ... change the DataColumn in
the parent DataTable on which the ForeignKeyConstraint was created, then the same
change is also made in any corresponding DataRow objects in the child DataTable. You
should...
- 6
- 428
- 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
Ngày tải lên :
20/02/2014, 01:20
... Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC
3 Department of Biochemistry, University of Minnesota College of Biological Sciences, St Paul, MN, USA
Staphylococcal nuclease (SNase) is a ... folding pathway: structure-based analysis of
staphylococcal nuclease. Proteins: Structure, Function
and Genetics 27, 171–183.
15 Flanagan JM, Kataoka M, Fujisawa T & Engelman
DM (1993) Mutations ... Salmon testes
DNA and some analytical grade chemicals such as EDTA,
Tris ⁄ HCl, CaCl
2
, NaCl and mineral oil were obtained from
Sigma (St Louis, MO, USA). Salmon testes DNA for the
enzyme activity...
- 7
- 551
- 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
Ngày tải lên :
06/03/2014, 01:20
... and 5¢-AUAAGUAAUUUCUACGACG
dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd
TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢
(siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢
and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ (siNup-
358-2)]. ... 5¢-AGCTTATCCTCGTTACAATCAA
GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG
A- 3¢) were annealed and inserted into the BglII and HindIII
sites of pEGFP-NLS. The oligonucleotide fragment for
NES-NLS was flanked ... dystrophy, cardiomyopathy and
Dunnigan-type partial lipodystrophy. J Cell Sci 114,
4435–4445.
13 Maeshima K, Yahata K, Sasaki Y, Nakatomi R,
Tachibana T, Hashikawa T, Imamoto F & Imamoto
N (2006)...
- 12
- 454
- 0
Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt
Ngày tải lên :
08/03/2014, 02:20
... of substrate activation of pyruvate decarboxylase: a
first approach. Eur. J. Biochem. 92, 175–181.
36. Rivoal, J., Ricard, B. & Pradet, A. (1990) Purification and partial
characterization of ... EcIPDC, a discontinuous
assay based on HPLC was used [7]. To analyse the kinetic
behaviour of the enzyme in more detail, a coupled optical
assay was elaborated with alcohol dehydrogenase as
auxiliary ... large amounts of indole-3-acetic acid.
Indolepyruvate decarboxylase, the key enzyme in the
biosynthetic pathway of indole-3-acetic acid, catalyses the
formation of indole-3-acetaldehyde and carbon...
- 10
- 430
- 0
Guidance on the teaching of writing skills INSET opportunities for teachers of a subjects across the curriculum at Key Stages 2 and 3 docx
Ngày tải lên :
10/03/2014, 05:20
... full advantage of this fact. There is a
significant body of research evidence to show that learners who speak more
than one language have an increased ability to use and learn language in
general. ... Welsh language coordinator of a primary or special
school and/or the appropriate head(s) of department in a secondary
school, a member of the school’s senior management team (SMT) or
the LA advisory ... content of the writing of many learners of all abilities is often marred by
inaccuracies in spelling, punctuation and grammar.
• Less-able learners often make slow progress in their learning because...
- 174
- 616
- 0
Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx
Ngày tải lên :
15/03/2014, 10:20
... of untreated Avicel.
Multivariate statistical analysis of X-ray data
The CrI of cellulose samples was also calculated by quanti-
fying the contribution of amorphous cellulose (PASC) and
Avicel ... shown are the average of quadrupli-
cates.
Fig. 5. Effect of crystallinity (obtained from X-ray diffraction data and
multivariate statistical analysis) on the initial rate in Avicel enzymatic
hydrolysis ... carbon signals in
NMR analysis could be obtained below a certain
degree of crystallinity and within a reasonable acquisi-
tion time, so that X-ray diffraction was used as an
alternative to map...
- 12
- 554
- 0
Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt
Ngày tải lên :
17/03/2014, 10:20
... 5¢-CATTGTTGAAGACATCAATGTTG-3¢ 5¢-CAACATTGATGTCTTCAACAATG-3¢ 43
N302F 5¢-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3¢ 5¢-GCTGCAACATTGATGAATTCAACAATGTAAAG-3¢ 43
I30 3A 5¢-CATTGTTGAAAACGCTAATGTTGCAG-3¢ 5¢-CTGCAACATTAGCGTTTTCAACAATG-3¢ ... 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢ 55
R103E 5¢-GAACACAACATTCTCTGTTCTCGAACC-3¢ 5¢-GGTTCGAGAACAGAGAATGTTGTGTTC-3¢ 55
DKR 5¢-GAAGTTAAAGATACAATGATTCAGCTC 5¢-GAGCTGAATCATTGTAACTTTAACTTC-3¢ 48
N302D 5¢-CATTGTTGAAGACATCAATGTTG-3¢ ... triple mutants.
Mutant Sense Primer Antisense Primer T
m
R101M 5¢-GAGTTTGGTTCGATGACAAGGAATGTTG-3¢ 5¢-CAACATTCCTTGTCATCGAACCAAACTC-3¢ 58
R103M 5¢-GTTCGAGAACAATGAATGTTGTGTTC-3¢ 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢...
- 12
- 380
- 0
Báo cáo khoa học: The crystal structure of a xyloglucan-specific endo-b-1,4glucanase from Geotrichum sp. M128 xyloglucanase reveals a key amino acid residue for substrate specificity potx
Ngày tải lên :
23/03/2014, 05:22
... Biological Resources and Functions, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Ibaraki,
Japan
2 Research Institute of Genome-based Biofactory, National Institute ... at both ends. In the case of
Xgh7 4A, the active cleft is open. Although a precise anal-
ysis of the mode of action of Xgh7 4A has not been
performed, Xgh7 4A appears to be an endoglucanase
because ... Prism (GraphPad Software, San Diego,
CA, USA). One unit was defined as the amount of enzyme
that released 1 lmol of glucose equivalent as reducing sug-
ars from xyloglucan per minute.
Analysis of substrate...
- 7
- 361
- 0
Báo cáo khoa học: Calpain 3: a key regulator of the sarcomere? pot
Ngày tải lên :
23/03/2014, 10:21
... motifs. Arch Biochem
Biophys 342, 99–107.
22 Sorimachi H, Kinbara K, Kimura S, Takahashi M, Ishi-
ura S, Sasagawa N, Sorimachi N, Shimada H, Tagawa
K, Maruyama K, et al. (1995) Muscle-specific calpain,
p94, ... Sorimachi H, Toyama-Sorimachi N, Saido TC,
Kawasaki H, Sugita H, Miyasaka M, Arahata K,
Ishiura S & Suzuki K (1993) Muscle-specific calpain,
p94, is degraded by autolysis immediately after transla-
tion, ... Kawamura Y,
Kanzawa N, Nakauchi Y, Kimura S, Kawashima S &
Maruyama K (1993) A novel domain sequence of
connectin localized at the I band of skeletal muscle
sarcomeres: homology to neurofilament...
- 10
- 350
- 0
Báo cáo Y học: Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids pot
Ngày tải lên :
24/03/2014, 03:21
... (5¢-GGAGGGTGGCAGCATGTCGTTCCTTGG
GG-3¢,forward),GSP 5a( 5¢-GTGGCTTCTTGAGTCAT
AGAATCGTGGATGAC-3¢, reverse) and GSP5b (5¢-GT
GCATACAACGAAGGCAATCGAGGTCC-3¢, reverse)
using Marathon
TM
cDNA Amplification ... & Hughes, M .A. (1994) Investigation of
theactivesiteofthecyanogenicb-
D
-glucosidase (linamarase) from
Manihot esculenta Crantz (cassava). II. Identification of Glu-198
as an active site carboxylate ... was
extracted with an equal volume of EtOAc, pH of the water
phase adjusted to 8.0 with 25% ammonia and extraction
with equal volume of EtOAc repeated. The organic phases
were evaporated and chromatographed...
- 10
- 650
- 0
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot
Ngày tải lên :
30/03/2014, 04:20
... 728–733.
72 Hayakawa M, Miyashita H, Sakamoto I, Kitagawa M,
Tanaka H, Yasuda H, Karin M & Kikugawa K (2003)
Evidence that reactive oxygen species do not mediate
NF-kappaB activation. EMBO ... vas-
cular endothelial growth factor stress response
increases the antitumor effects of ionizing radiation.
Cancer Res 59, 3374–3378.
101 Kanaan A, Farahani R, Douglas RM, Lamanna JC &
Haddad ... enzymes that lead to extracellular matrix degra-
dation (matrix metalloproteases) [75–78]. In addition,
NF-jB activation was reported as an early event in
malignant transformation in vitro [79], and...
- 12
- 390
- 0
Discussion paper: Key concepts of the Alternative Investment Fund Managers Directive and types of AIFM pptx
Ngày tải lên :
30/03/2014, 14:20
... the nature of the relationship and the responsibilities of each party.
VI. Treatment of UCITS management companies
48. Article 6(2) provides that an AIFM may also act as a management company ... relevant
in the application of the AIFMD, and to ensure uniform conditions of application of the AIFMD.
2. The different types of AIFM will manage a variety of AIF legal structures and a variety ... definition of AIFs in
Article 4(1) (a) of the AIFMD and which may be relevant to the national competent authorities and finan-
cial market participants when determining whether or not an entity falls...
- 18
- 379
- 0
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt
Ngày tải lên :
30/03/2014, 20:20
... Agrobiological Sciences (NIAS), Ibaraki, Japan
3 Graduate School of Science, Nagoya University, Aichi, Japan
4 Graduate School of Bioagricultural Sciences, Nagoya University, Aichi, Japan
5 Chubu ... Nakagaki
1
,
Yoshiaki Tanaka
2
, Akira Mizoguchi
3
, Toshinobu Yaginuma
4
and Okitsugu Yamashita
4,5
1 Faculty of Textile Science and Technology, Shinshu University, Nagano, Japan
2 National Institute of Agrobiological ... Iwami M, Nagasawa
H, Suzuki A & Ishizaki H (1990) Molecular cloning of
the Bombyx mori prothoracicotropic hormone. Science
247, 1333–1335.
7 Adachi-Yamada T, Iwami M, Kataoka H, Suzuki A &
Ishizaki...
- 10
- 437
- 0
ENHANCING THE COMMUNICATION SKILLS OF EDUCATIONAL MANAGERS IN VINH PHUC PROVINCE: BASIS FOR A TRAINING PROGRAM
Ngày tải lên :
13/05/2014, 15:15
... in management, communication has the
characteristics of management, but it retains its basic characteristics. Characteristics
of communication in management have peculiarities, valuable management ... characteristics of communication in the management of the management staff
inseparable characteristics of the object management and process management.
From the above communication management ... command manager.
The basic characteristics of communication in management are presented in
detail, the characteristics of the management system consists of three groups:
a. The management staff:...
- 125
- 397
- 0
