is a risk factor for atherosclerosis and liver fibrosis
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
Ngày tải lên :
07/03/2014, 05:20
... Fujita H, Yamanaka M, Imamura K, Tanaka Y, Nara
A, Yoshimori T, Yokota S & Himeno M (2003) A
dominant negative form of the AAA ATPase
SKD1 ⁄ VPS4 impairs membrane trafficking out of
endosomal ... D,
Uchimura S, Nara A, Yoshimori T, Hayashizaki Y,
Kawai J, Ishidoh K et al. (2004) Mammalian class E
Vps proteins, SBP1 and mVps2 ⁄ CHMP 2A, interact
with and regulate the function of an AAA-ATPase
SKD1 ... the meiotic clade of AAA ATPases
Parimala R. Vajjhala
1,2
, Chau H. Nguyen
1,2
, Michael J. Landsberg
1
, Carol Kistler
1,2
, Ai-Lin Gan
1,2
,
Glenn F. King
1
, Ben Hankamer
1
and Alan L. Munn
1,2,3,4
1...
- 23
- 490
- 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf
Ngày tải lên :
15/02/2014, 01:20
... glycerol
dehydratase-reactivating factor reactivates the inacti-
vated hologlycerol dehydratase in a similar manner.
Both dehydratase-reactivating factors exist as a
2
b
2
heterotetramers [a, DdrA or GdrA ... Mechanism of action of adenosylcobalamin:
glycerol and other substrate analogues as substrates and
inactivators for propanediol dehydratase – kinetics,
stereospecificity, and mechanism. Biochemistry ... biochemical evidence for this has been
obtained so far. A similar reactivating factor for
ethanolamine ammonia lyase has been reported [26].
It has also been reported that a protein named E
2
activates...
- 13
- 620
- 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt
Ngày tải lên :
06/03/2014, 01:20
...
x Information about health disparities related to hepatitis B and hepatitis C.
To increase knowledge and awareness about hepatitis B and hepatitis C in at -risk
populations and the general population, ... hepatitis B screening and related services to this high -risk population. There is a
pervasive lack of knowledge about hepatitis B among Asians and Pacific Islanders, and this is
probably also ...
anti-HCV Hepatitis C antibody
API Asian and Pacific Islander
AST Aspartate transaminase
AVHPC Adult viral hepatitis prevention coordinators
CDC Centers for Disease Control and Prevention...
- 191
- 457
- 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc
Ngày tải lên :
06/03/2014, 01:20
... Centers for Disease Control and Prevention; Chris Taylor
and Martha Saly, National Viral Hepatitis Roundtable; Lorren Sandt, Car-
ing Ambassadors Program; Joan Block, Hepatitis B Foundation; Gary ... reserved.
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C
http://www.nap.edu/catalog/12793.html
SUMMARY 3
1. There is a lack of knowledge and awareness about ... Settings That Target At -Risk Populations
STD and HIV clinics, shelter-based programs, and mobile health units
are settings that serve populations that are at risk for hepatitis B and hepa-
titis C....
- 253
- 369
- 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
Ngày tải lên :
18/02/2014, 13:20
... 5¢-CACAACGCCACCAACCATCAGA
CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab-
start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT
CCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTA
CACAACGCCACCAACCATCAG-3¢.
The PCR solution was prepared ... and
using the following primers: Aba, 5¢-ATGGACGCTGAAT
TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG
AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT
GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG
GGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGA
CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab-
start, ... enzyme, and contained Aba, Abb and Abcat
40 nm each, and the start and stop primers Abstart and
Abstop at 600 nm each, and 200 lm each of dATP, dCTP,
dGTP and dTTP. The product was separated from...
- 16
- 691
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
Ngày tải lên :
18/02/2014, 17:20
... tsA58T Ag cDNA carry-
ing the A4 38V mutation were PCR-amplified from COS-7
cDNAs using the following primers: LTA-1F, 5¢-CTC
GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA-
1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for ... organ-specific blood vascular and lymphatic
endothelial cells of the mouse
Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,
Nobuaki Yoshida and Hirotake ... knockouts can provide a partial
solution to this problem. Therefore, the isolation and
maintenance of murine endothelial cells from various
developmental stages and locations is important for
dissecting...
- 11
- 873
- 0
Tài liệu A Marketing Guide for Small and Medium Sized Primary Forest Products Processors pdf
Ngày tải lên :
18/02/2014, 22:20
... Program Assistant, Northeastern Area State and Private
Forestry, for desktop publishing; and Victoria Evans, Group Leader – Creative
Services, Northeastern Area State and Private Forestry, for ... case of small wholesalers and manufacturers, frequently pricing is more
of an art than a science. Manufacturing or purchase costs, overhead, general,
administrative and selling costs, and a ... changing
Wireless Terminal
this simple diagram illustrates how information
is transmitted across the Internet. Transmission
of information starts at a main server and is sent
across transmission...
- 92
- 2.2K
- 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt
Ngày tải lên :
19/02/2014, 05:20
... potential ligands for PTPr [41], and
recently syndecan and dallylike, both HSPGs, have
been reported as functional ligands for DLAR in Dro-
sophila motor axons and neuromuscular synaptogene-
sis [28,30,31]. ... phosphatases
sigma and delta. J Neurosci 26, 5872–5880.
35 Stoker AW, Gehrig B, Newton MR & Bay BH (1995)
Comparative localisation of CRYP alpha, a CAM-like
tyrosine phosphatase, and NgCAM in ... black dots, protease cleavage sites. (B) SDS ⁄ PAGE
separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose. (C) SDS ⁄ PAGE and silver
stain...
- 14
- 669
- 0
Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx
Ngày tải lên :
19/02/2014, 19:20
... plan to adapt our approach
to language pairs where one language is alphabetic
and the other language is non-alphabetic such as En-
glish/Japanese. These language pairs require one-
to-many character ... Association for Computational Linguistics
A Statistical Model for Unsupervised and Semi-supervised Transliteration
Mining
Hassan Sajjad Alexander Fraser Helmut Schmid
Institute for Natural Language ... standard.
Arabic nouns have an article “al” attached to them
which is translated in English as “the”. There are
various cases in the training data where an English
noun such as “Quran” is matched...
- 9
- 521
- 0
Tài liệu Báo cáo khoa học: "A Writing Assistant for CAT and CALL" pdf
Ngày tải lên :
22/02/2014, 03:20
...
participants found TransAhead suggestions
satisfying, accepted, and learned from them; c)
interactivity made translation and language
learning more fun and the participants found
TransAhead ... on
language learning. Specifically, our goal is to
build a human-computer collaborative writing
assistant: helping the language learner with in-
text grammar and translation and at the same ... European Chapter of the Association for Computational Linguistics, pages 16–19,
Avignon, France, April 23 - 27 2012.
c
2012 Association for Computational Linguistics
TransAhead: A Writing Assistant...
- 4
- 393
- 0
Tài liệu A Science Roadmap for Food and Agriculture pdf
Ngày tải lên :
22/02/2014, 05:20
... economic data are
needed to provide more accurate estimates
of climate change impacts, the potential
costs and benets of adaptation, and to
validate and calibrate models.
• Quantify costs and ... issues.
This Roadmap capitalizes on this
capacity. It directs investments into both
fundamental and translational research.
The translational research is integrated
with teaching and outreach to ...
States is secure and abundant, several
factors may lead to food insecurity and
decreased abundance in the near future.
They include global population growth,
climate change, and natural disasters....
- 104
- 415
- 0
Tài liệu Báo cáo khoa học: "A COMMON FRAMEWORK FOR ANALYSIS AND GENERATION" potx
Ngày tải lên :
22/02/2014, 10:20
... representa-
tion of linguistic knowledge for both analysis and
generation. We argue that the only part of the
average NL system's knowledge that we can have
any faith in is its vocabulary and, ... long as (a) it is reasonable to assume that
an application program can be relied on to pro-
duce realisable expressions in the representation
language and (b) there are any rules which satisfy ... Shieber and his col-
leagues takes a realisable A- calculus expression
and uses their syntactic/semantic rules "back-
wards" to generate appropriate text. Their em-
phasis is on controlling...
- 4
- 501
- 0
Hate on the Internet: A Response Guide for Educators and Families pptx
Ngày tải lên :
06/03/2014, 21:20
... is directed to Web sites that include hate propaganda from the
National Alliance and David Duke. “If you are a teacher or student, I hope you
will take a stand for right and wrong and use this ... 2001).
The National Alliance Web site features transcripts from a weekly anti-Semitic
radio broadcast, online access to many articles from the group’s National
Vanguard magazine, and a catalog of ... Internet: AResponse Guide for Educators and Families is designed to assist
educators and adult family members in preparing children of all ages for safe use
of the Internet. As Americans have expanded...
- 63
- 1.4K
- 0
Báo cáo khoa học: Purine nucleoside phosphorylases from hyperthermophilic Archaea require a CXC motif for stability and folding pot
Ngày tải lên :
07/03/2014, 00:20
... was analyzed by catalytic
activity measurements performed under standard condi-
tions.
Reactivation assay of SsMTAPII, PfPNP and their
CXC-lacking mutants
The activity of SsCSC and PfCGC as catalysts ... motif for stability and folding
Giovanna Cacciapuoti, Iolanda Peluso, Francesca Fuccio and Marina Porcelli
Department of Biochemistry and Biophysics ‘F. Cedrangolo’, Second University of Naples, ... incu-
bated for 22 h at 30 °C in the presence of
various oxidative folding catalysts (reactiva-
tion assay). The catalytic activity of (A) SsM-
TAPII and SsMTAPIIC259S ⁄ C261S and (B)
PfPNP and...
- 7
- 496
- 0
Acute and Chronic Sinusitis - A Practical Guide for Diagnosis and Treatment docx
Ngày tải lên :
16/03/2014, 14:20
... history, physical exam, appropriate
laboratory and imaging studies, and when indicated screen
patients for allergy
• Prescribe appropriate medication regimens for acute and
chronic sinusitis
• Know ... relationships between upper airway
(rhinosinusitis) and lower airway disease (asthma)
37
0031003
Additional Antibiotics for Acute
Bacterial Sinusitis
• Amoxicillin should be considered because ... Because
• Allergic or nonallergic rhinitis nearly always precedes sinusitis
• Sinusitis without rhinitis is rare
• Nasal discharge and congestion are prominent symptoms of
sinusitis
• Nasal mucosa...
- 81
- 534
- 0
- matrix metalloprotease2 is implicated in many biological processes and degrades extracellular and nonextracellular matrix molecules matrix metalloprotease2 maintains a latent state through a cysteine–zinc ion pairing which
- and there is an immediate need for the development of novel and more effective therapeutic modalities against this deadly disease
- confer a significantly elevated lifetime risk for breast and ovarian cancer
- what is a proxy server for lan
- what is a proxy server for ps4
- what is a proxy server for ps3
- a unifying framework for lbp and related methods
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2