integrated modeling of the muskegon river tools for ecological risk assessment in a great lakes watershed
Báo cáo y học: " Experimental ablation of the pancreas with high intensity focused ultrasound (HIFU) in a porcine model"
Ngày tải lên :
25/10/2012, 11:18
... pre-treatment imaging The integrated transducer was mounted in a degassed water reservoir with the ultrasound beam directed upward The ultrasound beam of the therapeutic transducer and the imaging ... procedure The pigs were fasted for 72 h and then administered folium sennae tea to clean the intestinal tract The skin covering the HIFU target area was shaved, washed with degassed water, and defatted ... structures The gas-containing organs such as the gastrointestinal (GI) tracts are poor transmitters of US beam which affects HIFU targeting and ablation [13] In our pilot study, damage to the adjacent...
- 7
- 481
- 0
báo cáo hóa học: " Oral administration of the KATP channel opener diazoxide ameliorates disease progression in a murine model of multiple sclerosis" ppt
Ngày tải lên :
19/06/2014, 22:20
... CA, USA) Data are expressed as the ratio of the band intensity of the protein of interest to the loading control protein band (b-actin) Isolation of total protein For spinal cord total protein ... correction, the integrated density of GFAP labeling was measured The integrated density is the area above the threshold for the mean density minus the background All analyses were performed blind with ... mice group Daily oral administration of diazoxide for 30 days starting from the same day as immunization was also examined Treatment produced a significant amelioration of the EAE clinical score...
- 18
- 422
- 0
Báo cáo y học: "Barriers to access prevention of mother-to-child transmission for HIV positive women in a well-resourced setting in Vietnam" pptx
Ngày tải lên :
10/08/2014, 05:21
... design, the data analysis, and coordination All authors read and approved the final manuscript 14 15 16 17 Acknowledgements The authors thank women in the Sunflower Group for participating in the interviews ... Hanoi: Ministry of Health; 2006 Samuel NM, Parameswari S, Jacob M: Evaluation of the efficacy and tolerance of Nevirapine in unregistered pregnant women in Namakkal, South India Proceedings of the ... was inadequate, many of them did not receive instructions on safe preparation of formula, which may lead to high risk of diarrhoea and other diseases for the newborn [11] There is little data...
- 12
- 368
- 0
Báo cáo y học: "Prevalence of Overactive Bladder, its Under-Diagnosis, and Risk Factors in a Male Urologic Veterans Population"
Ngày tải lên :
25/10/2012, 11:35
... demographic data Mean age was 68 years old (quartile range: 59-77) The major ethnicities were European American (44%), African American (37%) and Hispanic American (11%) Table Demographics Characteristics, ... ment initiation The OAB-V8 questionnaire is a possible effective and fast screening tool Our study also examined the risk factors for OAB in men We found that OAB increased with age: 49% in men aged ... of urinary symptoms and incontinence: the Canadian Urinary Bladder Survey BJU Int 2008; 101:52 Milsom I, Abrams P, Cardozo L, Roberts RG, Throff J and Wein A How widespread are the symptoms of...
- 4
- 520
- 0
Tài liệu Investigation of Organic Chemicals Potentially Responsible for Mortality and Intersex in Fish of the North Fork of the Shenandoah River, Virginia, during Spring of 2007 ppt
Ngày tải lên :
14/02/2014, 08:20
... allowing the use of the same models to determine ambient water concentrations Previous data indicate that many chemicals of interest remain in the linear phase of sampling for at least 56 days (Alvarez ... biofouling) or as the mass of chemical per sampler Data that are greater than the MDL, but less than the MQL, are shown in italics Any data less than the MQL have a large degree of statistical uncertainty ... intersex in fish have been increasing in regularity in the Shenandoah River and Potomac River basins in Virginia (Blazer and others, 2007) The fish kills and observations of intersex primarily have...
- 24
- 865
- 0
Báo cáo khoa học: "Quantitative modeling of the neural representation of adjective-noun phrases to account for fMRI activation" doc
Ngày tải lên :
30/03/2014, 23:20
... classifier would predict which of the 24 exemplars the participant was viewing and thinking about Separate classifiers were also trained for classifying the isolated nouns, the phrases, and the ... percentile rank of the correct class in this ordered output list Rank accuracy ranges from to Classification analysis was performed separately for each participant, and the mean rank accuracy was computed ... adjectives to modify the meaning of the noun, rather than conjoining the meaning of the adjective and noun In this study, we represented the meaning of both adjectives and nouns in terms of their...
- 9
- 270
- 0
Application of house’s model for translation quality assessment in assessing the english version of the vietnam’s law on investment no. 59/2005/qh11
Ngày tải lên :
07/11/2012, 14:36
... contain at least two clauses with each clause beginning with a cardinal number and each item within one clause beginning in a separate line with an alphabetical letter And except for Clause of Article ... Tiersma, the history of English legal language can be summarized as follows: The Anglo-Saxons drove away the Celtic language of the original inhabitants of England and their laws left traces in ... LIST OF DIAGRAMS Global Distribution of Legal Systems Page The schema for analyzing and comparing original and translation texts Page 30 INTRODUCTION Rationale for the study Globalization and integration...
- 86
- 896
- 5
Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge
Ngày tải lên :
05/09/2013, 09:38
... (5'!3') AGAGTTTGATCCTGGCTCAG GGCTACCTTGTTACGACTT CTGGAGTTTGGCAGAGGG GTTAGCTACGGCACTAAAAGG CCGTCATCTACWCAGGGTATTAAC CCCTCTGCCAAACTCCAG GTTAGCTACGGCACTAAAAGG GCTGCCTCCCGTAGGAGT GCAGCCACCCGTAGGTGT ... copies of the DNA quantification standard per reaction A linear regression line of the Ct values for the DNA standards versus logarithm of their starting copy number was constructed A typical linear ... Quantification using Quantitative PCR and FISH method in Activated sludge The amount of Candidatus ‘Accumulibacter phosphatis’ in the laboratory-scale and the full-scale activated sludge were quantified...
- 7
- 719
- 0
A STUDY ON THE USE OF CLASSROOM DISCIPLINE AS MOTIVATION FOR SECOND LANGUAGE ACQUISITION IN THE CONTEXT OF ENGLISH LANGUAGE TEAC
Ngày tải lên :
07/09/2013, 13:06
... is the learners and the teachers who play the primary role in managing a disciplined atmosphere in the classroom In the light of Communicative Language Teaching, where the roles of the learners ... and the same main point: the understanding of this relationship is exclusively vital for discipline to be satisfactorily maintained I.4 Factors affecting discipline and motivation in a language ... more than needed with all the discipline management tools at their disposal The learning environment is also an indispensable factor in shaping a smooth- running process in the language classroom...
- 41
- 887
- 12
Validity of the achievement written test for non major, second year students at economics department, hanoi open university
Ngày tải lên :
06/02/2014, 14:45
... training ED is one of the very first departments established at the same time of HOU There are teachers of English at ED, half of them have gained their master degrees, and the rest are doing their ... Most of them are good at grammar, they have acquainted with learning four language skills at first year: speaking, reading, writing and listening However, they are not used to learning business ... 2002 and is said to be one of the most authentic and updated materials that we think it may meet the demand of teaching and learning English at ED The material contains 15 units, but in our Department...
- 39
- 490
- 0
Tài liệu ENVIRONMENTAL HISTORY of the HUDSON RIVER doc
Ngày tải lên :
12/02/2014, 16:20
... Henshaw ABSTRACT INTRODUCTION For millennia, the impact of humans on the ecosystems of the Hudson River Valley was minimal That changed with the arrival of Europeans in 1609 Native Americans inhabited ... viewed as a “salt wedge” (Fig G.4) The salt wedge is extremely important to larval aquatic animals because they can maintain their location in the river simply as a result of their normal vertical ... subtle.” The good” are far too often overlooked and underappreciated and would include broad, far-reaching, and long-lasting management actions such as passage of the Clean Water Act and the Endangered...
- 407
- 708
- 0
Tài liệu THE FUTURE OF THE WILD Radical Conservation for a Crowded World ppt
Ngày tải lên :
17/02/2014, 17:20
... preserve in a State or National Park, a complete replica on a small scale of the flora and fauna of a much larger area.” You cannot make a Xerox reduction of nature and stash it away in some remote ... but on the intransigence of some within the Forest Service and their industry backers FEMAT had a daunting mandate: create a management plan for the forests within the range of the northern spotted ... statute but in a myriad of laws, including the Endangered Species Act, the National Environmental Policy Act, the National Forest Management Act, and others In the case of the spotted owl, the...
- 292
- 531
- 0
Tài liệu Báo cáo Y học: Molecular modeling of the dimeric structure of human lipoprotein lipase and functional studies of the carboxyl-terminal domain docx
Ngày tải lên :
21/02/2014, 15:20
... structures and lie close to each other, and a substantial conformational change in the C-terminal domain is induced The key heparin-binding site of basic amino acids in both peptides is located at a site ... of apoCII interacts with the interface of the N- and C-terminal domains of LPL and part of the lid surface [32] Because the functional importance of LPL’s C-terminal domain is increasingly appreciated, ... N-terminal domain of one subunit and the C-terminal domain of the other This hypothesis was suggested when Razzaghi et al demonstrated in a molecular modeling experiment that the C-terminal domain of...
- 10
- 679
- 0
FAQs Tuberculosis Component of the Technical Instructions (TIs) for the Medical Examination of Aliens in the United States doc
Ngày tải lên :
06/03/2014, 04:20
... and the applicant is no longer infectious, a representative of the health department should sign the “Referral Evaluation” section (Part 4) of the I-693 form, indicating that the applicant has ... of the medical examination? The civil surgeon should follow the 1991 Technical Instructions for Medical Examination of Aliens in the United States for all non-TB portions of the medical examination ... is Class A Pulmonary TB Disease, Active, Infectious? In Class A Pulmonary TB, the applicant has an abnormal chest radiograph suggestive of active TB disease (see Appendix B in the TB TIs), and...
- 8
- 474
- 0
Báo cáo khoa học: Identification of the structural determinant responsible for the phosphorylation of G-protein activated potassium channel 1 by cAMP-dependent protein kinase pdf
Ngày tải lên :
07/03/2014, 00:20
... with a PKA inhibitor and also in untreated oocytes On the other hand, the in vitro phosphorylation signal was markedly diminished when SpCAMPS, a PKA activator, was injected, indicating that the ... microgram of the appropriate protein was incubated in 300 lL of PhB containing 18.5 kBq [32P]ATP[cP] and 0.4 lL of PKA-cs for 30 at room temperature (agitated by a Labquake laboratory shaker; ... result of other protein kinases masking the PKA-catalysed part Indeed, protein kinases other than PKA, including 6222 tyrosine kinases, have been demonstrated to directly phosphorylate GIRK1 [12] The...
- 9
- 403
- 0
Sony vs. Samsung: The inside story of the electronics' giants battle for global supremacy
Ngày tải lên :
14/03/2014, 14:02
... Areas of Sony and Samsung Electronics Sony and Samsung Electronics’ Performance Part Strategic Analysis Chapter - Prince and Pauper in the Analog World Sony, the Prince of Analog The Late-Starter, ... products as well as for its global management I was fascinated by the late Akio Morita’s book, Made in Japan, and was impressed by his global mindset and business acumen This had led me to a research ... other Asian companies The History and Business Areas of Sony and Samsung Electronics Sony The King of AV In 1946, the year after Japan’s defeat in World War II, Sony was incorporated as the Tokyo...
- 490
- 705
- 1
Office of the Deputy Inspector General for Auditing FY 2013 Audit Plan ppt
Ngày tải lên :
15/03/2014, 23:20
... cost and availability of spare parts for the C-27/G222 will allow for continued sustainability of the aircraft for the Afghan Air Force Datron Radio Contracts to Support the Afghan National Security ... related to the reliability of the financial reporting and compliance with laws and regulations that pertain to the financial statements Department of the Army Working Capital Fund Basic Financial ... — Financial Management Health Care — Equipping and Training Iraqi and Afghan Security Forces Joint Warfighting and Readiness — Nuclear Enterprise Information Assurance, Security, and Privacy...
- 54
- 563
- 0
Báo cáo khoa học: Molecular basis of the unusual catalytic preference for GDP/GTP in Entamoeba histolytica 3-phosphoglycerate kinase doc
Ngày tải lên :
16/03/2014, 01:20
... putative amino acid side chains interacting with the guanine moiety were detected From this structural analysis it became evident that the amino group at carbon of the guanine ring may interact ... ATP ⁄ ADP to the guanine nucleotides must be acquired by a cooperative effect of several amino acid side chains Amino acid residues interacting with the guanine moiety of GDP in EhPGK The amino ... efficiencies Therefore, the increased Vmr and decreased Km values for ATP were in agreement with the results obtained for ADP in the forward reaction It is worth noting that although changes in catalytic...
- 11
- 449
- 0
Multilevel modeling of the influence of surface transport peculiarities on growth, shaping, and doping of si nanowires
Ngày tải lên :
16/03/2014, 15:18
... in the value of Y and all parameters associated with this value including axial and radial growth rates As the input flux increases, the concentration of adatoms at the outset increases gradually ... Here, h is the height of the NW and O is the atomic volume of a silicon atom in a silicon lattice, the factor is the ratio of the catalyst external surface area to that of the interface for a hemispheric ... can obtain a simple balance equation for the mean concentration of adatoms at the catalyst particle surface (shown in Fig in the form of a hemisphere of radius R) We note that the NW axial growth...
- 8
- 514
- 0