if month of hire is used as a row label the pivottable will look at your data and pick out the unique values to make up the row headings within your report
Ảnh hưởng của D psicose sử dụng như là chất thay thế đường mía vào đặc điểm của bánh trứng đường .Effect of d psicose used as sucrose replacer on the characteristics of meringue
Ngày tải lên :
24/08/2015, 20:41
... vessels and heated at the heating rate of 0.5 °C/min from 25 to 120 °C in an N2 atmosphere The calorimetric data were analyzed using thermal analysis software from The diluted baked meringue extract ... cup Then, the foam was leveled off using a spatula and weighed The percent overrun was calculated Baked meringue and rapeseeds were then placed together in using the following equation: container ... proceeds fast with Psi compared to the other d-ketohexoses Conclusion The replacement of Suc with d-ketohexoses caused increase in foaming capacity and decrease in heat denaturation temperature of EWP...
- 7
- 400
- 0
Báo cáo hóa học: " Could sound be used as a strategy for reducing symptoms of perceived motion sickness?" docx
Ngày tải lên :
19/06/2014, 08:20
... JD also participated in the analysis of the results and preparation of the manuscript AS participated in the experimental trials, were responsible for the statistical analysis and participated ... movement data After that, the average number of fixations (NoFix) and fixation duration (Fixdur) over the time periods was calculated for each subject In order to compare actual fixation time ... the drafting of the manuscript TL participated in the drafting of the study and the final preparations before submission TF Participated in the design and preparations of the study TF also participated...
- 9
- 609
- 0
Báo cáo y học: "Can HRCT be used as a marker of airway remodelling in children with difficult asthma?" docx
Ngày tải lên :
12/08/2014, 16:20
... bronchoalveolar lavage and EB as part of their clinical assessment in order to help confirm the diagnosis of asthma and to exclude any other associated abnormalities such as structural airway abnormalities ... biopsies was calculated as the % coefficient of variation, by dividing the standard deviation of the measurements by the mean All analyses were performed using the Statistical Package for the Social ... which is a feature of some patients with asthma Kasahara and colleagues reported a significant negative correlation between post-bronchodilator forced expiratory volume in one second (FEV1) and...
- 9
- 390
- 0
performance of robust controller for dfim when the rotor angular speed is treated as a time-varying parameter
Ngày tải lên :
26/10/2014, 14:39
... frozen values of the rotor speed Then the performance of the LTI controller designed for a fixed value of is evaluated with other constant values of as well as with a fast variation of the rotor ... , and the outputs , as well as the stator voltages , and the control errors , This may cause a large tracking error for the controlled system since the stator voltages and are the input disturbances ... speed is considered as a time-varying parameter This particular choice is motivated by the fact that , which causes the system to be nonlinear, can be measured online The value of the rotor angular...
- 10
- 336
- 0
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university
Ngày tải lên :
29/01/2014, 10:33
... which was used in this study is qualitative All comments, remarks assumptions and conclusion of the study were based on the data and analysis Data collections for analysis in the study were gained ... most researchers and teachers continue to agree on: the first one is that listening is an active rather than a passive process and the second is that listening is both a top-down and bottom -up process ... English songs are too difficult to listen and too complicated to understand and that they would prefer to listen to Vietnamese songs These illustrations are very important as they relate to the...
- 39
- 1.1K
- 3
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
Ngày tải lên :
06/03/2014, 09:22
... SRp40 ASF ⁄ SF2, SRp40 hnRNP A1 , hnRNP E1 ⁄ E2 hnRNP A1 ASF ⁄ SF2 hnRNP A1 UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown ... is an accessory gene product of HIV-1 and affects both viral and cellular proliferation by mediating long terminal repeat activation, cell cycle arrest at the G2 phase and apoptosis It is also ... mRNAs are spliced at site A3 The rev mRNAs are spliced at sites A4 a, A4 b or A4 c, and the nef mRNAs are spliced at site A5 [9,10] Nef mostly modulates the physiological status of the host cell to...
- 10
- 434
- 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
Ngày tải lên :
06/03/2014, 22:21
... AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA ... ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT GTACTTGCGCTCAGGAGGAG 178 246 ... BCRP CA9 BMP2 MT 2A CD237904 AL707095 AK095731 DKK1 BC037851 b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA...
- 13
- 563
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
Ngày tải lên :
07/03/2014, 10:20
... formation Summary Oxidative stress, tau hyperphosphorylation and the Ab biology of AD are all intricately linked, and considerable research data now exist to indicate that they interact in a series ... neurofibrillary degeneration Tau hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD ... is down-regulated by decreased availability of intracellular Cu [83] and up- regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of...
- 9
- 634
- 0
a study on impacts and effectiveness of abc costing method as a cost effective measurement in coal industry
Ngày tải lên :
13/03/2014, 14:19
... accountants will establish some standards for these groups such as how many items in a group, what is the characteristics to classify them into a batch and etc After allocating cost to a group, managers ... based on the advantages of these methods, the affects on the decisions of managers can be obvious As a result, the author of this thesis hopes that the empirical study of advantages and disadvantages ... competitive advantages as well as disadvantages of this industry will be covered This background will help the readers understand and draw a big picture of this industry After this, a statistics about the...
- 64
- 512
- 0
Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc
Ngày tải lên :
18/03/2014, 01:20
... optimal amount of arachidonic acid determined for each assay of oxidase activation [12] The rate of O2– production by the activated NADPH oxidase was calculated from the rate of the superoxide dismutase-inhibitable ... Rac was maintained at a value of 4, i.e a nonsaturating concentration with respect to p47phox and Rac2 (cf Fig 3A) The concentration of flavocytochrome b was maintained at a fixed value, and the ... proteins is associated with the heterodimer S10 0A8 /A9 via p67phox, and that this association is determinant in the potentiation of oxidase activation On the other hand, the physiological meaning of the...
- 10
- 396
- 0
Báo cáo sinh học: "Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" pot
Ngày tải lên :
18/06/2014, 22:20
... University of Virginia Health System and office of Human Subjects Research at the NIH Information on post-operative radiation and/ or chemotherapy, and performance status of patients was unavailable ... However, there was no association between cytoplasmic Her3 staining and any of the clinicopathological parameters examined (Table 2) When comparing primary tumor samples and matching metastatic samples, ... terms of overall survival and hazard ratio in subsets of patient stratified according to Her2 and Her3 membranous staining status A total of 262 patients (67.7%) had tumors that were negative...
- 10
- 490
- 0
báo cáo hóa học:" Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" doc
Ngày tải lên :
20/06/2014, 04:20
... University of Virginia Health System and office of Human Subjects Research at the NIH Information on post-operative radiation and/ or chemotherapy, and performance status of patients was unavailable ... However, there was no association between cytoplasmic Her3 staining and any of the clinicopathological parameters examined (Table 2) When comparing primary tumor samples and matching metastatic samples, ... terms of overall survival and hazard ratio in subsets of patient stratified according to Her2 and Her3 membranous staining status A total of 262 patients (67.7%) had tumors that were negative...
- 10
- 479
- 0
báo cáo hóa học:" The validity of self-rated health as a measure of health status among young military personnel: evidence from a cross-sectional survey" pot
Ngày tải lên :
20/06/2014, 15:20
... health and discharge from the military was examined The following is a description of key variables used to validate self-rated health ratings: Smoking status Smoking status was assessed with the ... smoking status and discharge from the military Smoking status at the one-year follow up was assessed using a 7-day point prevalence analysis [16] Discharge was assessed both after BMT and after technical ... White and Asian/Pacific Islander participants reported the poorest health and Hispanic and African Americans the highest, the opposite has been true in previous studies It is possible that this is...
- 9
- 301
- 0
Báo cáo toán học: " Music expression with a robot manipulator used as a bidirectional tangible interface" pptx
Ngày tải lên :
20/06/2014, 20:20
... has been extended with music mappings, as explained later in this section The robot is used as a haptic interface to create low frequency oscillators and automations, and as a remotely operated ... perform a collaborative manipulation activity such as lifting an object, and where the robot shows, after learning, the capability to adapt to human motions and learn both the dynamic and communicative ... with a robot manipulator used as a bidirectional tangible interface Victor Zappi∗ , Antonio Pistillo, Sylvain Calinon, Andrea Brogni and Darwin Caldwell Department of Advanced Robotics, Istituto...
- 34
- 323
- 0
Báo cáo hóa học: " Biofabrication of Anisotropic Gold Nanotriangles Using Extract of Endophytic Aspergillus clavatus as a Dual Functional Reductant and Stabilizer" potx
Ngày tải lên :
21/06/2014, 08:20
... incubated at 25°C for 20 days until the mycelia of endophytic fungi appeared Each isolate was then grown and examined to ascertain that it originated from a single spore Based on literature and other ... biomass-based reduction Characterization of Gold Nanotriangles Experimental Details Isolation of Endophytic Aspergillus clavatus The host plant Azadirachta indica A Juss was surveyed, and samples ... P, Ahmad A, Mandal D, Senapati S, Sainkar SR, Khan MI, Ramani R, Parischa R, Kumar PAV, Alam M, Sastry M, Kumar R: Angew Chem Int Ed 2001, 40:3585 14 Ahmad A, Senapati S, Khan MI, Kumar R, Ramani...
- 7
- 261
- 0
báo cáo hóa học:" Music expression with a robot manipulator used as a bidirectional tangible interface" potx
Ngày tải lên :
21/06/2014, 17:20
... has been extended with music mappings, as explained later in this section The robot is used as a haptic interface to create low frequency oscillators and automations, and as a remotely operated ... perform a collaborative manipulation activity such as lifting an object, and where the robot shows, after learning, the capability to adapt to human motions and learn both the dynamic and communicative ... with a robot manipulator used as a bidirectional tangible interface Victor Zappi∗ , Antonio Pistillo, Sylvain Calinon, Andrea Brogni and Darwin Caldwell Department of Advanced Robotics, Istituto...
- 34
- 183
- 0
Báo cáo khoa học: "Alteration of nitrergic neuromuscular transmission as a result of acute experimental colitis in rat" pot
Ngày tải lên :
07/08/2014, 18:21
... ehT )ASU ,SSPS ;0.2 noisrev( tatsamgiS ,margorp lacitsitats eht gnisu dezylana saw atad eht llA )deliat-owt( tset deriap a gnisu derapmoc erew noitcefni eht retfa dna erofeb deniatbo seulav citenikocamrahp ... sa detaluclac saw ]∞ CUA[ ytinifni ot morf CUA ehT elur ladiozepart raenil eht gnisu detaluclac saw )CUA( evruc emit -noitartnecnoc amsalp eht rednu aera latot ehT noisserger raenil gnisu ... noitalucric ni segnahc eht ot dnopserroc snoitaretla lacigoloehr esehT tuptuo caidrac ni sesaerced dna sisodica yradnoces yb dewollof era ecnatsiser larehpirep dna etar yrotaripser dna caidrac...
- 5
- 205
- 0
Báo cáo khoa học: "Bony metastases from breast cancer - a study of foetal antigen 2 as a blood tumour markerl" doc
Ngày tải lên :
09/08/2014, 03:21
... patients with both skeletal and extra-skeletal metastases FA-2 Assays The serum samples were transported at -20°C to the Williamson Laboratory at St Bartholomew's Hospital FA-2 radioimmunoassays ... and their measurements can be repeated as required The use of blood tumour markers is most established in the diagnosis and monitoring of symptomatic metastatic disease In the diagnosis of metastatic ... identification of the pattern of changes of serum FA-2 levels in relation to bisphosphonate therapy and events such as hypercalcaemia are areas that need to be explored before the use of FA-2...
- 4
- 286
- 0