for a n efficient contextfree parser augmented

Báo cáo khoa học: "FOR A N EFFICIENT CONTEXT-FREE PARSER AUGMENTED PHRASE-STRUCTURE GRAMMARS" potx

Báo cáo khoa học: "FOR A N EFFICIENT CONTEXT-FREE PARSER AUGMENTED PHRASE-STRUCTURE GRAMMARS" potx

Ngày tải lên : 09/03/2014, 01:20
... interpretation in parallel with syntactic analysis. It has been implemented in Franz Lisp and runs on VAX 11/780 and, recently, also on a SUN workstation, as the main component of a transportable ... grammars (APSGs), and the semantic grammars. All of them have different characteristics and different advantages. In particular APSGs offer a natural tool for the treatment of certain natural ... this sentence. 5.Conclusions and future developments At present the parser described above has been efficiently employed as a component of a natural language front-end. The natural language...
  • 7
  • 303
  • 0
Báo cáo y học: "The Diels-Alder-Reaction with inverse-Electron-Demand, a very efficient versatile Click-Reaction Concept for proper Ligation of variable molecular Partners"

Báo cáo y học: "The Diels-Alder-Reaction with inverse-Electron-Demand, a very efficient versatile Click-Reaction Concept for proper Ligation of variable molecular Partners"

Ngày tải lên : 26/10/2012, 09:39
... genetic materials as a cargo to carrier and address-molecules to realize high local concentrations of active substances and is able to circumvent the barriers on the way to a save and efficient ... as well as in the big molecu- lar weight result in a barely noticeable diffusibility, insufficient for therapeutic local concentrations or for an intravital diagnostics imaging. Both approaches ... hormone-refractory prostate cancer [37-39]. Addi- tionally this DAR inv technology attracts increasing notice to further medical applications, especially in oncological diagnostics and therapy...
  • 10
  • 623
  • 0
Tài liệu For a New LibertyThe Libertarian Manifesto Revised Editionby Murray N. RothbardCollier pdf

Tài liệu For a New LibertyThe Libertarian Manifesto Revised Editionby Murray N. RothbardCollier pdf

Ngày tải lên : 16/02/2014, 01:20
... has just transformed into a wheatfield—and vice versa of course for an Iowan baby and a Pakistani farm. Land in its original state is unused and unowned. Georgists and other land communalists ... for the advantage of the nation-state; and industry and manufacturing by the old feudal and agrarian order. And they wanted to replace the new world of mass consumption and rising standards of ... usher in a century of death and devastation, of wars and new despotisms, and also a century in all warring countries of the new corporatist statism— of a welfare-warfare State run by an alliance...
  • 349
  • 324
  • 0
Tài liệu Báo cáo khoa học: "A Fast, Accurate Deterministic Parser for Chinese" pdf

Tài liệu Báo cáo khoa học: "A Fast, Accurate Deterministic Parser for Chinese" pdf

Ngày tải lên : 20/02/2014, 12:20
... augmented by transformation-based learning. ACM Transactions on Asian Language Information Processing, 3(2):159–168. Mary Hearne and Andy Way. 2004. Data-oriented parsing and the Penn Chinese ... described in (Sagae and Lavie, 2005) is employed to con- vert between arbitrary branching trees and binary trees. This transformation breaks multi-branching nodes down into binary-branching nodes by in- serting ... times faster than Levy and Manning’s parser, and 270 times faster than Bikel’s parser. Another advan- tage of our parser is that it does not take as much memory as these other parsers do. In fact, none of...
  • 8
  • 390
  • 0
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

Ngày tải lên : 16/03/2014, 16:20
... Sequence (5¢fi3¢) MA(9) ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC MGA(8) ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC MG6S GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC MG6X ... GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC MG3K6S7K GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC T3 AATTAACCCTCACTAAAGGG B1 GCCGGGATCCTAGGGCGAATTGGGTACC 864 T. Utsumi et al. (Eur. ... AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC 6F-XHO AATTCTCGAGTGCTGCTGCTGCGAATGCTGC C3K -A7 K GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG HC-K 7A GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG MG3K6S GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC MG3K6S7K...
  • 12
  • 512
  • 0
Báo cáo khoa học: "A Psycho linguistically Motivated Parser for CCG" potx

Báo cáo khoa học: "A Psycho linguistically Motivated Parser for CCG" potx

Ngày tải lên : 17/03/2014, 09:20
... constructed and main- tained in parallel until disambiguating information arrives. Indeed, there is psycholinguistic evidence that the processor maintains the various analyses in parallel (Nicol and ... containing a for each lexical entry e of the word make a copy a ~ of a add the leaf derivation e to the right of a ~ add a ~ as a new analysis • combine for each analysis a in the parser& apos;s ... non-left-branching derivation turns out to have been necessary. For example, when parsing (5), Pareschi and Steedman's algorithm constructs the left branching analysis for 'John...
  • 8
  • 167
  • 0
Báo cáo khoa học: "A Cascaded Finite-State Parser for German" pot

Báo cáo khoa học: "A Cascaded Finite-State Parser for German" pot

Ngày tải lên : 17/03/2014, 22:20
... Spain. David Elworthy, Tony Rose, Amanda Clare, and Aaron Kotcheff. 2001. A natural language system for retrieval of captioned images. Journal of Natural Language Engi- neering, 7(2):117-142. Sandra ... constituent, one for each conjunct in left-to-right order (cf. example (5)). (5) Hans( (N ;A) (N; D)) [[kennt Maria( (A; N) )] und [hilft Karla((D ;N) )]]. Hans knows Maria and helps Karla. or: Maria knows and ... Karla helps Hans. or: Maria knows Hans and he helps Karla. or: Hans knows Maria and Karla helps him. In a final processing step, the constituent trees are converted into dependency tuples. In...
  • 4
  • 391
  • 0
Giải pháp để giải quyết những vướng mắc, trở ngải trong việc triển khai , thúc đẩy tiến độ triển khai dự án.DOC

Giải pháp để giải quyết những vướng mắc, trở ngải trong việc triển khai , thúc đẩy tiến độ triển khai dự án.DOC

Ngày tải lên : 06/09/2012, 12:00
... khiê n những ban ngành li n quan phải tập trung tháo gỡ, sẽ a nh hưởng tới ng n sách và các nguô n lực cu a tỉnh. B n cạnh đó, mỗi dự a n tr n đi a ba n tỉnh thành công sẽ ... qua n lý nhà n ớc Đối với các cơ quan qua n lý,câ n có những chính sách phát triê n, quy hoạch dài ha n một cách hợp lý. Câ n châ n chỉnh các cơ quan qua n lý dự a n, nhằm ... không phải gặp những khó kh n không a ng có với những thủ tục. Câ n thiết lập một cổng thông tin nhanh nhạy để truyê n a t và tiếp nhâ n những ý kiê n, thông tin cu a nhà...
  • 12
  • 742
  • 0
Luận án Phần mềm quản lí nhân sự.pdf

Luận án Phần mềm quản lí nhân sự.pdf

Ngày tải lên : 22/09/2012, 16:56
... GhiChu) 6.Tbl_BangCongNVCB(MaBangCongNVCB,MaNV, SoNgayCong, SoNgayNghi, SoNgayLamThemNV, CongThang, CongNam, GhiChu) 7.Tbl_DM_Luong_PC (MaLuong, MaNV, ChucVu, LCB, PCCVu, PhuCapKhac, NgayNhap) 8.Tbl_CheDo ... danh 5 NgaySinh Datetime 8 Ngày sinh 6 GioiTinh Nvarchar 3 Gi i tínhớ 7 TTHonNhan Nvarchar 50 Tình tr ng h n nh n 8 CMND Char 12 Ch ng minhứ nh n d n 9 NgayCap Datetime 8 Ngày c pấ 10 NoiCap Nvarchar ... ThoiGian, NgayKy, NgayHetHan, SDT, NgoaiNgu, TrinhDoNN, HocVan , Anh,ghichu) 2.Tbl_PhongBan (MaBoPhan, MaPhong, TenPhong, NgayTLap, ghichu) 3.Tbl_BoPhan( MaBP, TenBP, GhiChu) 4.Tbl_HoSoThuViec (MaHSTV,...
  • 68
  • 665
  • 1
Đánh giá hiệu quả thương mại và tính giá trị gia tăng, thặng dư xã hội do dự án đem lại cho nền kinh tế quốc dân của dự án đầu tư vào khai thác mỏ Felspat (Sơn Mã – Lào Cai) t.doc

Đánh giá hiệu quả thương mại và tính giá trị gia tăng, thặng dư xã hội do dự án đem lại cho nền kinh tế quốc dân của dự án đầu tư vào khai thác mỏ Felspat (Sơn Mã – Lào Cai) t.doc

Ngày tải lên : 24/09/2012, 17:20
... những lợi ích mà dự a n mang lại trong ngă n ha n và dài ha n cho n n kinh tế, cho cộng đồng xã hội như: Tạo công n việc làm, cải thiê n môi trường, đóng góp cho ng n sách, ... phương pháp này là người ta quan tâm đê n yếu tố thời gian cu a đồng tiê n tức là xuất phát từ quan điểm đồng tiê n sống và có khả n ng sinh sôi theo thời gian do lãi vay. ... Do a nh hưởng cu a lãi vay, đồng tiê n bỏ ra hôm nay sau một thời gian nào đó sẽ trở n nn h n và ngược lại (giả thiết là ở đâu ch a tính đê n tỷ lệ lạm phát, giảm...
  • 24
  • 1.1K
  • 3
Phân tích chiến lược công ty sữa vinamilk trên cơ sở lựa chọn các phương án hội nhập dọc.doc

Phân tích chiến lược công ty sữa vinamilk trên cơ sở lựa chọn các phương án hội nhập dọc.doc

Ngày tải lên : 24/09/2012, 17:21
... Dielac + Nhà máy S a C n Thơ + Nhà máy s a Bình Định + Nhà máy S a Nghệ An + Nhà máy s an i + Xí nghiệp kho V n 4. Ngành nghề kinh doanh: Vinamilk đã b n s n phẩm thông qua tr n 220 nhà ph n ... bảo được ngu n nguy n liệu n định, đáng tin cậy với giá cạnh tranh nhất tr n thị trường. Là nhà thu mua s a l n nhất cả n ớc n n có khả n ng mặc cả với người ch n nuôi + N ng lực nghi n cứu và ... đồng dài ha n Vinamilk cho rằng khả n ng duy trì ngu n cung s a nguy n liệu n định vô cùng quan trọng đối với việc kinh doanh, giúp công ty duy trì và tăng s n lượng. Vinamilk a xây dựng và...
  • 36
  • 2.6K
  • 19