fleshing out a standardized format
Báo cáo y học: " A Dietary Supplement Containing Standardized Phaseolus vulgaris Extract Influences Body Composition of Overweight Men and Women"
Ngày tải lên :
31/10/2012, 15:12
... a purified alpha-amylase
inhibitor from white kidney bean (Phaseolus vulgaris). Food Re-
search International, 1998; 31:217-225.
17. Hansawasdi C, Kawabata J, Kasai T. Alpha-amylase inhibitors ... placebo or a test formula containing a
starch blocker
as the principal active ingredient. [Phase
2 Starch Neutralizer
TM
, also known as Phaseolamin 2250
TM
and Phase2
TM
(Pharmachem Laboratories, ... Purification and partial characterization
of two alpha-amylase inhibitors from black bean (Phaseolus vul-
garis). J Food Biochem 1984; 1:385-401.
16. Gibbs B, Alli I. Characterization of a purified...
- 8
- 740
- 1
Formatting a Pivot Table
Ngày tải lên :
09/10/2013, 12:20
... Conditional Formatting: Changing the
Data Range
Problem
In your pivot table, Date is in the Row Labels area, Territory is in the Column Labels area, and
Sales is in the Values area. You applied Above ... layout, the formatting is retained
and adjusts to the new layout.
CHAPTER 4
■
FORMATTING A PIVOT TABLE72
Solution
You can use conditional formatting icon sets to illustrate the data. These small pictures ... applied Above Average conditional formatting to the Values
cells, and it is working as expected. The sales manager has asked for a last-minute change to
the pivot table layout, and he would like...
- 30
- 379
- 0
Unit 8 Out and About A 1 -A 3
Ngày tải lên :
23/10/2013, 08:11
... his car
1 Listen and read.
We are walking to school
They are walking to school
We are travelling to school by bus
We are waiting for a train
They are waiting for a train
They are travelling ...
start
1234
5
6
78
9
10
What are you doing?
I am playing video games
c.What is he doing?
3 Answer then write.
He is driving his car
d.What are they doing?
3 Answer then write.
They are waiting for a train
... Listen and read.
What is he doing?
He is riding his bike
Ask and answer.
Ride (v)
:Ñi/cöôõi (xe
a p,xe maùy)
b.What is she doing?
c.What is he doing?
a. What are you doing?
d.What are...
- 46
- 477
- 0
A general framework for studying class consciousness and class formation
Ngày tải lên :
01/11/2013, 07:20
... framework
10. A general framework for studying
class consciousness and class
formation
In one way or another, most class analysts believe that at the core of class
analysis is a relatively simple causal ... and class formation, but rather as a
framework for de®ning an agenda of problems for empirical research within
class analysis. In the multivariate empirical studies of class conscious-
ness and ... of analysis, typically an entire society. To say that someone is
``in'' a managerial class location is to claim that they are embedded in a
set of interindividual interactions (relations)...
- 31
- 500
- 0
How to get out of the friendzone: turn your friendship into a relationship
Ngày tải lên :
10/02/2014, 18:17
... he met Cara at his coed dodgeball tournament. She was
pretty and nice and seemed to like him back. They started dating
and things were going well.
At a party soon after Sam and Cara started seeing ... seeing each other, Sam
ran into Katie, who threw her arms around him and whispered
that they needed to talk; she’d heard he was dating someone and
wanted to know all about it. After hearing about ... environment.
James and Tiana both started at an insurance company on the
same day two years ago. There were five other newbies who
started with them, but they all seemed kind of vanilla, so James
and Tiana...
- 240
- 1.1K
- 1
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
Ngày tải lên :
18/02/2014, 08:20
... deletion in Saccharomyces cerevisiae.
Nucleic Acids Res 21 , 3329–3330.
45 Ito H, Fukuda Y, Murata K & Kimura A (1983)
Transformation of intact yeast cells treated with alkali
cations. J Bacteriol ... because of the absence of the catalytic
subunit ISP (Table 1). Figure 3A shows that a band of
approximately 500 kDa was also found in this mutant
strain when the mitochondrial membranes were ana-
lyzed ... c
oxidase complex was clearly demonstrated [10–12], but
also in other organisms, such as Neurospora crassa
[13], mammals [11] and plants [14]. A higher-order
organization of the respiratory chain...
- 15
- 639
- 0
Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx
Ngày tải lên :
19/02/2014, 05:20
... spectrum of acid-dena-
tured cytochrome c (spectrum a of Fig. 8A) displays
an absorption maximum around 395 nm in the Soret
region, and a maximum at 497 nm, a shoulder at
528 nm and a charge transfer ... from
Sigma (St Louis, MO, USA) and used without further puri-
fication. High-purity guanidine-HCl was obtained from
ICN (Costa Mesa, CA, USA). All the reagents used were
of analytical grade.
Construction ... wavelength and at
a given time interval, A
¥
is the absorbance at longer time
intervals (when the reaction is completed), DA
i
is the absor-
bance change for phase I, k
i
is the rate constant for phase
I,...
- 11
- 487
- 0
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf
Ngày tải lên :
19/02/2014, 17:20
... kDa), alcohol dehydrogenase (a, 141 kDa) and
catalase (c, 250 kDa) were loaded on to a separate gradient as molecular mass markers.
Novel aggregate formation of an alkaline phosphatase frame-shift ... 68 kDa), alcohol dehydrogenase
(a, 141 kDa) and catalase (250 kDa) were
loaded on to a separate gradient as mole-
cular mass markers.
K. Komaru et al. Novel aggregate formation of an alkaline ... Michigami T, Yamamoto T, Yasui N, Satomura
K, Yamagata M, Shima M, Nakajima S, Mushiake S,
Okada S & Ozono K (1998) Analysis of localization of
mutated tissue-nonspecific alkaline phosphatase...
- 14
- 445
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
Ngày tải lên :
19/02/2014, 17:20
... L. lactis ald gene as follows.
A PCR fragment was generated using primer CP-pyk
(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT
GACANNNNNNNNNNNNNNTGRTATAATNNNNAA
GTAATAAAATATTCGGAGGAATTTTGAAATGAATA
AACGTGTAAAAATCG-3¢)(N¼ ... (5¢-GGAAGGA
TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4
(5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were
amplified. The PCR products were digested with XhoI ⁄
BamHI and BamHI ⁄ XbaI, respectively, and cloned ... TP901-1 phage attachment site. PCR products
upstream to pyk using primer pyk1 (5¢-TGGTACTCGAG
CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG
AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and
downstream to pyk...
- 12
- 616
- 0
Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx
Ngày tải lên :
22/02/2014, 07:20
... for a phage l integrase mutant was set as 100%. In each case,
data were collected from six separate transfection assays, each
employing two wells containing about 2 Â 10
5
cells. (C) Normalized
b-Gal ... order to inactivate the TRE-CMV
promoter, doxycyclin (20 ng
:
mL
21
) was added 2 weeks
prior to electroporation.
b-Galactosidase (b-gal) assays, Southern blotting and
PCR
b-Gal assays and Southern ... [14]. Strand exchange is catalyzed by dimers
bound at paired sites I, while those bound at sites II and III
serve accessory roles in synaptosome formation and in the
activation of strand cleavage...
- 7
- 472
- 0
Báo cáo khoa học: Replacement of two invariant serine residues in chorismate synthase provides evidence that a proton relay system is essential for intermediate formation and catalytic activity docx
Ngày tải lên :
07/03/2014, 05:20
... and 127 of the Neurospora crassa
chorismate synthase with alanine, producing two single-mutant proteins
(Ser16Ala and Ser127Ala) and a double-mutant protein (Ser16Ala-
Ser127Ala). The residual ... substantial
decrease in activity beyond the detection limit of our
assay. In contrast to the single-mutant proteins
(Ser16Ala and Ser127Ala) the Ser16AlaSer127Ala dou-
ble-mutant protein was not able ... Ser127Ala mutant proteins
or 12.5 lm of the Ser16Ala and Ser16AlaSer127Ala mutant
proteins). Chorismate formation was monitored at 275 nm
under anaerobic conditions.
For determination of the decay...
- 10
- 398
- 0
Báo cáo khoa học: "Generating Usable Formats for Metadata and Annotations in a Large Meeting Corpus" pptx
Ngày tải lên :
08/03/2014, 02:21
... order to generate tabular files
(TSV) and a table-creation script.
4. Create and populate metadata tables within
database.
5. Adapt the XSLT stylesheet as needed for vari-
ous table formats.
5 Results: ... NLP and XML at ACL 2004),
pages 9–16, Barcelona.
96
4 Metadata: Generation of Explicit Files
and Conversion to Tabular Format
As mentioned in Section 2, metadata denotes here
any static information ... metadata
and annotations. The annotation files are
converted to a tabular format using an eas-
ily adaptable XSLT-based mechanism, and
their consistency is verified in the process.
Metadata files are...
- 4
- 373
- 0
Báo cáo khoa học: Assessment of porcine and human 16-ene-synthase, a third activity of P450c17, in the formation of an androstenol precursor doc
Ngày tải lên :
08/03/2014, 08:20
... used as standards, showed
elution peaks at 4.70, 2.30 and 2.50 min, respectively
(Fig. 2). In both porcine and human assays using preg as
a substrate, an additional peak of elution appeared at
15 ... T., Nagata, K., Yamazoe, Y., Kato, R., Matsunaga, E.,
Gelboin, H.V. & Gonzalez, F.J. (1990) Cytochrome b5potentia-
tion of cytochrome P-450 catalytic activity demonstrated by a
vaccinia virus-mediated ... work has been supported by a grant from the Canadian Institutes
of Health Research. The authors would like to thank Guy Reimnitz,
Nathalie Paquet and Mei Wang for their technical assistance and...
- 7
- 612
- 0
Báo cáo khoa học: a-Fetoprotein positively regulates cytochrome c-mediated caspase activation and apoptosome complex formation docx
Ngày tải lên :
08/03/2014, 08:20
... initiatory
caspase 8 and caspase 1 [21]. Although these studies have
shown that a caspase cascade is initiated during AFP-
induced apoptosis, the mechanisms by which AFP triggers
caspase activation are ... caspase 3, producing similar
52-kDa and 35-kDa fragments. Our data allow us to suggest
that AFP may negatively regulate fragmentation of cIAP-2,
thus modulating its antiapoptotic activity. Alternatively,
AFP ... in a cell-free system in
the absence of procaspase 9.
AFP cannot induce activation of procaspase 9
in the absence of caspase 3
As AFP was unable to activate procaspase 3 in the absence
of procaspase...
- 12
- 401
- 0