films miller et al introduced a small amount of low bandgap chromophores such as anthracene perylene or cyanostilbene into the backbone of pf to suppress the excimer emission 22 27 the su

HBT characterization and modeling for nonlinear microwave circuit design

HBT characterization and modeling for nonlinear microwave circuit design

Ngày tải lên : 17/09/2015, 17:20
... HBTs, such as AlGaAs/GaAs, GaInP/GaAs in the GaAs-based HBTs, InP/InGaAs, InAlAs/InGaAs in InP-based 21 HBTs, Si/SiGe in Si-based HBTs and AlGaN/GaN in sapphire-based HBTs AlGaAs/GaAs is the first ... material structure 18 Emitter N - AlGaAs Base Base P+ - GaAs Collector N- - GaAs Collector N+- GaAs Semi-insulating GaAs Substrate Figure 1.2 The schematic diagram of a typical AlGaAs/GaAs HBT ... HBT transistor and total S-parameters can be obtained Then, total S-parameters need to be converted to the total Z-parameters Using an appropriate set of initial values for RE , LE , RB , RC and...
  • 212
  • 746
  • 0
Báo cáo khoa học: The mouse Muc5b mucin gene is transcriptionally regulated by thyroid transcription factor-1 (TTF-1) and GATA-6 transcription factors pdf

Báo cáo khoa học: The mouse Muc5b mucin gene is transcriptionally regulated by thyroid transcription factor-1 (TTF-1) and GATA-6 transcription factors pdf

Ngày tải lên : 15/03/2014, 00:20
... our laboratory has allowed the identification of GATA factors as activators of mucin gene expression [15,16], such as GATA-4 for Muc2 in intestinal cells [15], with obvious association between ... CGCGAGCTCTTGCTCCCTGGGGGCCTG CGCACGCGTGGCACAGTGATGTAAATC CGCGAGCTCCCAGGGCCCTTGAGAC CGCACGCGTCCTGGGGGCAGTACA CGCGAGCTCCAGGGACCCTGCCAG CGCACGCGTCCTGGGGGCAGTACA S AS S AS S AS S AS S AS S AS FEBS Journal 278 (2011) ... fi 3¢) Orientation CGCGAGCTCCACATAGACTTTTCCCTT CGCACGCGTGGCACAGTGATGTAAATC CGCGAGCTCCCAGGGCCCTTGAGAC CGCACGCGTGGCACAGTGATGTAAATC CGCGAGCTCCAGGGACCCTGCCAG CGCACGCGTGGCACAGTGATGTAAATC CGCGAGCTCTTGCTCCCTGGGGGCCTG...
  • 13
  • 240
  • 0
Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc

Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc

Ngày tải lên : 15/03/2014, 00:20
... domain was interpreted as a consequence of the additional interaction between Ssa1p and the flexible N-terminal moiety of Ure2p, which is critical for assembly An alternative explanation that can ... analyses as described in the Materials and methods and Fig S1 Given the variety of theoretical cross-links and modifications, exact mass measurements were insufficient to unambiguously identify all the ... build an inclusion list with the light and heavy precursor masses for cross-linked candidate peptides analysis NanoLC-LTQ-Orbitrap data were processed automatically as described as well as manually...
  • 12
  • 510
  • 0
Giáo án Tiếng anh lớp 6 - Unit 8: OUT AND ABOUT - Lesson 7( C3-4 ) docx

Giáo án Tiếng anh lớp 6 - Unit 8: OUT AND ABOUT - Lesson 7( C3-4 ) docx

Ngày tải lên : 03/07/2014, 19:20
... giao lộ the book ( page 90 ) and ask: - Do you know these road signs? - Have Ss guess the meaning of these road signs - Have Ss read the text and find the name of these road signs - Ask Ss: What ... There’s a stop sign I must stop 3-h: You can’t park your car here 10’ 4 -a: You must slow down There’s an intersection ahead - Have Ss listen to the tape 5-g: You can enter that road Look at the ... reading: 10’ you see these road signs? - Listen and correct - Give the corrections - Have Ss notice how to use and the III Post- reading: meaning of must and mustn’t a Slow down V - Call Ss to...
  • 4
  • 3.1K
  • 5
Giáo án tiếng anh lớp 5 - UNIT 5 SPORTS AND GAMES Section A(4, 5, 6, 7) Period 22 ppsx

Giáo án tiếng anh lớp 5 - UNIT 5 SPORTS AND GAMES Section A(4, 5, 6, 7) Period 22 ppsx

Ngày tải lên : 23/07/2014, 15:20
... (It’s an exitting game) - Call some pairs talk in front of the class -Call two Ss write on the board 7.Let’s play T remark One S has an apple said: IV Other activity: Do you want to (play badminton)? ... Post-listen Call some Ss give result Key: Do you want to play football? Sure It’s an exitting game Do you want toplay badminton, Alan? Sure Let’s go Do you want to play hide-and seek,LiLi? Sure Let’s ... pairs practice in front of the Guide Ss to say class 1.I play football every day Other listen and remark 2 .The girl in the red dress is playing chess Let’s write Pre-write Activity 4(10’) Talk...
  • 6
  • 1.1K
  • 1
Giáo án Anh văn lớp 7 : Tên bài dạy : UNIT ONE : BACK TO SCHOOL. Lesson 5: B. Names and addresses (6). pot

Giáo án Anh văn lớp 7 : Tên bài dạy : UNIT ONE : BACK TO SCHOOL. Lesson 5: B. Names and addresses (6). pot

Ngày tải lên : 06/08/2014, 16:20
... T: asks Ss to look at the form in part - T: introduces the aim of this part: Ask their classmates some information then fill in the form - Ss gives the questions for the information - T: makes ... T: asks Ss to listen to the tape then find out the distance between the places - T: plays the tape for Ss times - Ss exchange the result with the partner - T: calls on some Ss to give the results ... results in front of the class - T: plays the tape again for Ss to check their answers - T: corrects and gives the correct answers: a School to Lan’s house : 300m b Lan’s house to the post offfice :...
  • 6
  • 716
  • 0
Báo cáo khoa học: "Teratological effect of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD): induction of cleft palate in the ddY and C57BL/6 mouse" pptx

Báo cáo khoa học: "Teratological effect of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD): induction of cleft palate in the ddY and C57BL/6 mouse" pptx

Ngày tải lên : 07/08/2014, 14:23
... paraffin and stained with hematoxylin and eosin (H&E) Data analysis The litter was considered the basic experimental unit The Kruskal-Wallis test was used to assess the analysis of variance The significance ... purchased from Radian International, Cambridge Isotope Laboratories, Inc., Andover, MA, USA, and its purity was 98 % TCDD was initially dissolved in a small volume of acetone and subsequently adjusted ... very resistant to the fetal mortality and the induction of cleft palate following TCDD treatment In fetal mortality, when TCDD was orally administered, the effects of TCDD appeared at 40 µg/kg bw...
  • 7
  • 659
  • 0
Báo cáo khoa học: " Radiosensitization by 2-benzoyl-3-phenyl-6,7-dichloroquinoxaline 1,4-dioxide under oxia and hypoxia in human colon cancer cells" pdf

Báo cáo khoa học: " Radiosensitization by 2-benzoyl-3-phenyl-6,7-dichloroquinoxaline 1,4-dioxide under oxia and hypoxia in human colon cancer cells" pdf

Ngày tải lên : 09/08/2014, 10:21
... CometScore™ software, a fully automatic image analysis system The following parameters were used to assess DNA damage: total fluorescence of the comet, fluorescence of the tail, percentage of DNA in the ... DNA damage by DCQ in irradiated DLD-1 cells under oxia and hypoxia To determine if DCQ is a DNA-targeting agent, the extent of DNA damage was measured by the alkaline COMET assay in oxic or hypoxic ... media containing no drugs and left in the incubator for 24 hours The extent of DNA fragmentation was determined by TUNEL assay and measured by flow cytometry The percentage of apoptotic cells was...
  • 13
  • 229
  • 0
Báo cáo y học: "Collagen-induced arthritis in C57BL/6 mice is associated with a robust and sustained T-cell response to type II collagen" pot

Báo cáo y học: "Collagen-induced arthritis in C57BL/6 mice is associated with a robust and sustained T-cell response to type II collagen" pot

Ngày tải lên : 09/08/2014, 10:21
... biologic (anti-TNF mAb), a disease-modifying anti-rheumatic drug (methotrexate), and a nonsteroidal anti-inflammatory drug (indomethacin) Clinical score was assessed, as a measure of spread of disease ... provides many factors that are able to break tolerance via activation of Toll-like receptors The therapeutic profile of CIA in the B6 mouse was similar to that of RA, with a therapeutic action of methotrexate ... Germany) and the diameter was expressed as an average for inflamed hind paws per mouse Animals were also scored for clinical signs of arthritis [13] as follows: = normal, = slight swelling and/or...
  • 8
  • 372
  • 0
Báo cáo y học: " Glycine tomentella Hayata inhibits IL-1b and IL-6 production, inhibits MMP-9 activity, and enhances RAW264.7 macrophage clearance of apoptotic cells" docx

Báo cáo y học: " Glycine tomentella Hayata inhibits IL-1b and IL-6 production, inhibits MMP-9 activity, and enhances RAW264.7 macrophage clearance of apoptotic cells" docx

Ngày tải lên : 10/08/2014, 05:21
... Statistics The data were analyzed with GraphPad Prism software by one-way analysis of variance (one-way ANOVA) to determine the significance between sets of categorical data A p-value of < 0.05 was considered ... 5’-GCTCATGACATCGACCA GAA-3’, 5’-ATCCACAACTCGCTCCAAGA-3’ (forward and reverse mouse iNOS probe), 5’-TCACTCAA GATTGTCAGCAA-3’, 5’-AGATCCACGACGGACA CATT-3’ (forward and reverse mouse GAPDH probe) Gelatin-zymography ... Black arrows indicate the macrophages and white arrows the apoptotic cells In parallel, flow cytometry was used to detect the phagocytosis of (C) apoptotic cells and (D) latex beads The data was...
  • 9
  • 217
  • 0
Bài giảng tham khảo thao giảng Anh 6 Unit 16 Man and the environment (7)

Bài giảng tham khảo thao giảng Anh 6 Unit 16 Man and the environment (7)

Ngày tải lên : 10/06/2015, 09:55
... lot of produce? fields and he produces a Mr Hairice Near his house, he he produce field vegetables? a few has a small and he grows Does he produce any vegetables? Does any vegetables He also has ... Mr Hai He is plowing with his buffalo He has What does he have? ANSWER THE QUESTIONS ANSWER THE 1/ Listen and repeat: QUESTIONS Mr Hai is a farmer He has some paddy How much rice does Mr Hai produce? ... produce? buffalo They plow the paddy fields and pull a cart He has a few cows They produce a little How many eggs his chicken produce? How has some chickens They produce a lot milk Hemany eggs his...
  • 22
  • 389
  • 0
Bài giảng điện tử tham khảo thao giảng, thi GV anh 6 Unit 13 Activities and the seasons (7)

Bài giảng điện tử tham khảo thao giảng, thi GV anh 6 Unit 13 Activities and the seasons (7)

Ngày tải lên : 16/06/2015, 14:58
... HOMEWORK What’s the weather like in winter? It’s cold 8 What you usually in the fall? I usually……………………… What you usually eat in the winter? I usually eat…………………… 11 12 2 What’s the weather ... to the park Winter Watch television Fall Go to the movies 2b Make dialogues with a partner: What you in the spring ? I always ride my bike What you do? I usually go fishing Minh Ba 2c.Write about ... like in the spring? It’s warm 9 Where you usually go in the summer? I usually go to …………… What weather you like? I like…………………… 10 What’s the weather like in the fall? It’s cool 3 Which sports...
  • 29
  • 294
  • 0
The KMP (peasant movement of the philippines)  movement generation, activity, and continuity in philippine society 6  7

The KMP (peasant movement of the philippines) movement generation, activity, and continuity in philippine society 6 7

Ngày tải lên : 17/09/2015, 17:18
... for May Movement, CPA for Cordillera People’s Alliance, CLAA for Central Luzon Aeta Association, PAMALAKAYA for National Movement of Fisherfolks, GABRIELA for National Alliance of Women’s Organizations ... occupation by the DAGAMI organization of a portion of land owned by the TABACALERA Inc and ANCA Corporation in Ilagan, Isabela in 1990 319 More than a decade has passed and no news of land occupation ... concretization of national issues at the local level Similarly, political education at the local and national levels meets in the process of dialectically studying local and national peasant situationers...
  • 86
  • 301
  • 0
2295 irregular verbs  groups 6 7 and 8

2295 irregular verbs groups 6 7 and 8

Ngày tải lên : 28/08/2016, 17:06
... Group Substitute the “d” for a “t” and you get the verbs in simple past and past participle Group The verbs in simple past and past participle end in “old” Sell – sold -sold Tell – told - told ... -sold Tell – told - told Group The verbs in simple past and past participle end in “old” Sell – sold -sold Tell – told - told Group The verbs in simple past and past participle end in “ound” Bind ... bound Find – found - found Grind – ground - ground Wind – wound - wound Group The verbs in simple past and past participle end in “ound” Bind – bound - bound Find – found - found Grind – ground...
  • 6
  • 167
  • 0
Marketing Quốc tế  Bài giảng + Case study chương 4,5,6,7,8

Marketing Quốc tế Bài giảng + Case study chương 4,5,6,7,8

Ngày tải lên : 25/10/2012, 08:58
... Adapted from W Chan Kim and R A Mauborgne, “Cross-Cultural Strategies,” Journal of Business Strategy (Spring 1987): 31; and John A Quelch and Edward J Hoff, “Customizing Global Marketing,” Harvard ... inspections charges Profit or mark-up Inland freight to Unloading at port/air port Terminal charges Export duty (if any) Loading charges 1-9 FOB 10 Ocean/air freight to destination ... tranh đ a phương Theo quan điểm tiếp thò Điều chỉnh chiến lược theo thò trường nước High Need for Adaptation Degree of Cultural Grounding Low Industrial/ Technology Intensive Consumer Nature of...
  • 78
  • 2.2K
  • 6
English for Tourism and Hospitality 6

English for Tourism and Hospitality 6

Ngày tải lên : 05/11/2012, 09:52
... The Stir Fry The Steamed Vegetables are enough for The Beef in Black Bean Sauce is a b c d e two people to share quite filling with our guests rather hot has mushrooms, tofu and garlic Language ... quite hot steamed Language Practice – Describing dishes Match the start of the sentence with the correct ending Practise saying them with your friends The Crispy Fish is very popular The Garlic Chicken ... Key vocabulary Look up the meaning and pronunciation of these words in your dictionary appetisers chillies ginger ready boiled crispy order sauce coconut dishes popular sounds chicken garlic quite...
  • 2
  • 913
  • 29
English for Tourism and Hospitality 6

English for Tourism and Hospitality 6

Ngày tải lên : 05/11/2012, 16:27
... Australian? Jean: Yes, we Jack: I'll have Australian thanks Mona: Just a bottle of water for me, thank you Jean: Certainly Ỳour beer, Sir… and water for you, Madam Now, are you ready to order? Jack: ... to see a menu? Mona: Yes, we would, thank you Jean: Can I get you anything to drink while you decide? Jack: I'll have a light beer, thank you Jean: Local or imported? Jack: Do you have Australian? ... you're eating, I recommend the Pearl Garden Cabaret It's also within walking distance Mona: Oh no, we'd like a quiet restaurant Leo: Then I suggest the Golden Lotus It's just two doors down, on the...
  • 7
  • 417
  • 4
Quản trị nhân lực - Chương 6,7,8,9

Quản trị nhân lực - Chương 6,7,8,9

Ngày tải lên : 06/11/2012, 16:30
... động lực lao động su t lao động cao tinh thần sáng tạo có nhiều sáng kiến cải tiến công việc 11 Các học thuyết tạo động lực Thuyết hệ thống nhu cầu Maslow: ( Nhu cầu sinh lý => nhu cầu an to n => ... việc Năng su t lao động cao thoả mãn với công việc Các nội dung cụ thể giai đoạn Trong gia đoạn cấp quản trị trực tiếp cấn trang bị cho nhân viên nội dung sau: Chức phận, phòng ban Nhiệm vụ ... giá - Đ a đánh giá mức độ tốt hay việc thực công việc người lao động; hay nói cách khác việc ấn định số thứ hạng để phản ánh mức độ thực công việc người lao động theo đặc trưng hay kh a cạnh...
  • 57
  • 825
  • 1
Tỷ lệ khò khè ở học sinh 6-7 tuổi

Tỷ lệ khò khè ở học sinh 6-7 tuổi

Ngày tải lên : 16/11/2012, 09:23
... Giang, there hasn’t been any survey of the prevalence of asthma and asthma symptoms Objectives: To determine the prevalence of wheezing and characteristic features of physiciandiagnosed asthma ... due to asthma and the rate of emergency room visits in the last year was 19%; school absences due to asthma in last year were 29% while mean days of missing school due to asthma came to 6.8 days ... 33.2% and physician - diagnosed asthma 2.2% Prevalence of undiagnosed asthma was estimated at high level 21 cases of physician - diagnosed asthma have some characteristic features: admission magnitude...
  • 21
  • 475
  • 1

Xem thêm