elements in combination with the ada lcr increases egfp expression in t cell lines

Báo cáo sinh học: "Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression" potx

Ngày tải lên : 14/08/2014, 19:22

... SAGiL test this property Results, shown in Figure 2, suggest that the ADA LCR is orientation-independent, in that the LCR in the inverted direction within both SAGiL and SiLAG does not substantially ... primers 5'GTACCGCTAGC GATATCAGTTCGCTTCTCGC3' and 5'GTAATACGACTCACT ATAGGG3', the fragment was digested with NheI and NotI and inserted into the corresponding sites in the shortened WTPG vector backbone ... observed in all T- cell lines tested, suggesting that the ADA LCR is functioning to increase gene expression in T- cell lines (Figure 3B) Incorporation of the ADA LCR did not result in enhanced gene expression...

12
210
0

Báo cáo y học: ""Shock and kill" effects of class I-selective histone deacetylase inhibitors in combination with the glutathione synthesis inhibitor buthionine sulfoximine in cell line models for HIV-1 quiescence" doc

Ngày tải lên : 12/08/2014, 23:21

... hypothesized that glutathione depletion might create an intracellular environment that facilitates HIV-1 activation by HDACIs To test this hypothesis, we evaluated the HIV-1 activating effects ... expected to provide insight into these phenomena Moreover, the "therapeutic window" (i.e the differential toxicity in uninfected vs infected cells) still needs to be widened In this regard, the ... and BSO activates HIV-1 at concentrations that show low toxicity in uninfected cells, and it induces cell death in infected cell cultures These results are consistent with a model in which BSO...

10
418
0

Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx

Ngày tải lên : 19/02/2014, 05:20

... contains 15 lg total RNA The bottom panel shows the expression of 18S rRNA as an internal control Note that the blot was exposed to the ﬁlm for the longest time (1 min) to detect the low expression ... hemintreated HepG2 cells Taken together with the siHO-2mediated induction of HO-1 expression, these results suggest that HO-2 rather than HO-1 may play the predominant role in heme degradation in cultured ... protein was normalized with respect to the intensity of the b-actin signal The ratio of each normalized value to the control value in siRNA-untreated cells (control) is shown as the relative expression...

14
487
0

Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt

Ngày tải lên : 23/03/2014, 09:21

... randomly into the genome; tetR follows in the second transfection In the ﬁnal transfection, Flp recombinase from a cotransfected plasmid is used to integrate the plasmid for protein expression into the ... 1.7 0.6 0.8 the on-state (this amounts to stimulation by a factor of 9.7) Thus, the background in the off-state was much lower with pEBTetD than with pEBTet However, in contrast to expression ... endogenous ET content was determined in parallel and subtracted from total ET content to yield the carrier-mediated increase of ET during the incubation with substrate (1 min, 10 lmolÆL)1) With nontransfected...

8
331
0

Báo cáo sinh học: "Combination therapy with vemurafenib (PLX4032/RG7204) and metformin in melanoma cell lines with distinct driver mutations" pdf

Ngày tải lên : 18/06/2014, 19:20

... combined in constant ratios to each other Among the 11 BRAFV600E mutant cell lines, in cell lines the combination was antagonistic and in cell lines it was synergistic (Figure 1b) In two cell lines ... treatment, the blue line with metformin, and the red line with combination treatment b) Combination index for the combination of μM vemurafenib and 10 mM metformin of all melanoma cell lines tested The ... inhibitory effect against the wild type M257 cell line (Figure 2d) In two NRASQ61 mutant cell lines the combination induced a G2 arrest Of note, the effects of single agent metformin or the combination...

13
518
0

Tài liệu Báo cáo khoa học: Identiﬁcation and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebraﬁsh, Danio rerio docx

Ngày tải lên : 16/02/2014, 09:20

... AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG ... Real-time TTCCAGTCCCGGTATATGCT Real-time TGAGTTACACGTTCAGTCAGCAATATG Real-time TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ... GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG...

20
689
0

Báo cáo Y học: GPI-microdomains (membrane rafts) and signaling of the multi-chain interleukin-2 receptor in human lymphoma/leukemia T cell lines doc

Ngày tải lên : 17/03/2014, 23:20

... thought to be distributed either randomly or associated with other membrane microdomains (e.g those accumulating TrfR) at the surface of the T cell lines investigated Supporting the detergent-resistance ... expected to abolish clustering of their protein constituents [21] Therefore, two cell lines, the IL-2-dependent Kit225 K6 and the IL-2-independent HUT102B2 cells, were treated with water-soluble methylb-cyclodextrin ... subunits resulting in decoupling of the intracellular interaction (crosstalk) between Jaks associated to the b and cc chains, respectively These interactions are known to be essential in the formation...

10
499
0

Báo cáo khoa học: The subcellular localization of vaccinia-related kinase-2 (VRK2) isoforms determines their different effect on p53 stability in tumour cell lines pdf

Ngày tải lên : 30/03/2014, 11:20

... substrates of VRK2B On the left is shown the detection of the proteins with Coomassie Brilliant Blue staining and to the right is shown the incorporation of radioactivity (D) Interaction between ... interactions with different proteins Their regulation is likely to be controlled by the different C-terminus, which determines their interaction with other regulatory proteins not yet identiﬁed, but whose ... identity in their catalytic domains, with no conservation in other parts of the protein, suggesting functional differences between the two kinases that have yet to be characterized It has been postulated...

18
333
0

Easy PHP websites with the zend framework (w jason gilmore) (2011)(t)

Ngày tải lên : 23/06/2014, 13:03

... frequency of mistakes creeping into the code is by integrating testing into the development process, rather than treating it as something which occurs after the Easy PHP Websites with the Zend Framework ... prior to the invocation of any action found in the controller See the last chapter for more information about the init() method Disabling the Layout To prevent the layout from rendering, call the ... importance that I wanted to at least introduce the syntax in this early chapter The syntax is only slightly different from that used to retrieve a GET parameter, involving the _request object's getPost()...

236
391
1

Báo cáo y học: " DNA methylation patterns associate with genetic and gene expression variation in HapMap cell lines" ppt

Ngày tải lên : 09/08/2014, 22:23

... transcription factor binding sites, histone-modifications, and with respect to distance to the probe We extended the model to fit the methylation data, where the reference point was the location ... distribution of the first principal component loadings in the autosomal data, suggesting that the first methylation principal component may in part capture technical variation potentially related ... of the eQTL data taking into account DNA methylation, in only 10% of eQTLs was the genetic effect of the SNP on expression affected by controlling for methylation, suggesting that variation in...

13
396
0

báo cáo khoa học: "Co-existence of acute myeloid leukemia with multilineage dysplasia and Epstein-Barr virus-associated T-cell lymphoproliferative disorder in a patient with rheumatoid arthritis: a case report" docx

Ngày tải lên : 10/08/2014, 22:20

... induce LPD in RA patients [23] The fact that withdrawal of MTX led to improvement of LPD in 30– 50% of the patients also suggested a direct MTX interaction with immune system [24] Several studies ... Editor -in- Chief of this journal http://www.jhoonline.org/content/2/1/27 10 11 12 13 14 15 16 17 Competing interests The authors declare that they have no competing interests 18 Authors' contributions ... reported that RA itself is not a risk factor of LPD [25] It remains unclear whether the co-existence of the three conditions are coincidental or there could be an intrinsic mechanism Conclusion The...

6
314
0

Báo cáo y học: "Systems biology-defined NF-κB regulons, interacting signal pathways and networks are implicated in the malignant phenotype of head and neck cancer cell lines differing in p53 status" pps

Ngày tải lên : 14/08/2014, 08:20

... for the RELA binding site; CDKN1A, 5'biotin-ACTGAGCCTTCCTCACATCCTCCTTCTTCAGGCTTGGGCTTTCCACCTTT-3' for the RELA binding site, 5'-biotinAGGTGAATTCCTCTGAAAGCTGACTGCCCCTATTTGGGACTCCCCAGTCT-3 for the ... 2008, GGGGAATCCCAGTTGG-5' for the NFκB1 binding site; LAMB3, 3'-biotin-ACTTGTGGTCAGGTCTGTTTTCTGGCCCTCCAGG CGGGCATTCCTGCCTA-5' for the RELA binding site, 3'-biotin-GGTGAGGCTGTTGTTTAAAAACCTGGAGCCGGGAGGGGAGACCCCCACAT-5' ... binding motif of the IL8 promoter generated by Active Motif as the positive control (5'-biotin-GGGCCATTTACCGTAAGTTATGTAACGCGCCTGGGAAATTCCACTCAACT-3'; the underlined sequence is the NF-κB binding...

22
434
0

THE REGULATORY ROLE OF MATRIX METALLOPROTEINASES IN T CELL ACTIVATION

Ngày tải lên : 24/08/2014, 11:37

... of the cysteine residue within the pro-domain interacting with the Zn2+ ion in the catalytic domain Disruption of this cysteine-zinc interaction, by proteolysis for example, causes a conformational ... residue at the N-terminus, and contains a cysteine residue in the conserved sequence PRCXXPD The cysteine within this conserved sequence is termed the “cysteine switch” due to its interaction with ... receptor Thy1.1 Thymus cell antigen 1, theta Thy1.2 Thymus cell antigen 2, theta TIMP Tissue inhibitor of matrix metalloproteinases TGF-β Transforming Growth Factor beta Th1 T helper xxv Th2 T helper...

202
322
0

Role of hodgkin and reed sternberg cell derived lymphotoxin alpha in t cell recruitment into the microenvironment of hodgkin lymphoma lesions

Ngày tải lên : 10/09/2015, 09:29

... active lymphotoxin-α (LTα) in the KM-H2 cells In combination with LTα neutralizing antibody, LTα derived from KM-H2 cells is proven to be the dominant mediator in stimulating ECs ECs stimulated ... phenotype of specific immune cells into subset that could contribute to their survival and growth The most obvious example is the shifting of the anti-tumor THelper1 response to tumorpromoting THelper2 ... on their functions can divide T cells into T helper cells, cytotoxic T cells and regulatory T cells 1.2.1 T helper (TH) Cells There are four basic types of THelper cells: THelper1, THelper2, THelper17...

204
400
0

The accessory roles of lipopolysaccharide activated murine b cells in t cell polarization

Ngày tải lên : 14/09/2015, 08:27

... in insects as MD-2 does in vertebrates with respect to the recognition of LPS Their data indicated that Der p had the protein fold most compatible with the sequence of MD-2 Therefore, these two ... associates with the TIR domain of TLRs TIR domain-containing adaptor protein Chapter Introduction 11 (TIRAP) is another adaptor molecule that is required for a link between TLR4 and MyD88 (Yamamoto ... control the type of T helper cell differentiation still remain elusive The environmental and genetic factors mixed together can define the Th1/Th2 differentiation mainly by modulating the interplay...

250
384
0

Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc

Ngày tải lên : 20/02/2014, 03:20

... determined as the amounts of inorganic phosphorus bAmount of proteins in the BCh-bound membrane fraction was estimated by subtracting the amount in the unbound fraction from that in the total ... other to maintain the ‘off’ state of T- cell signalling Taken together, the BCh-bound cholesterol-enriched subpopulation contains both activator and inhibitor molecules for TCR signal transduction, ... silver staining and western blotting (Fig 3A,B) Almost all BCh was recovered in the avidin-magnet bead-bound fraction as determined by detection with antih-toxin antibody, indicating that most BCh-bound...

10
588
0

Báo cáo khoa học: Internalization of cystatin C in human cell lines docx

Ngày tải lên : 16/03/2014, 06:20

... recombinant human cystatin C for up to h The cystatin C content of the cell extract (representing intracellular cystatin C) was quantiﬁed by ELISA and the cystatin C level was correlated to the ... analysis, the tested cell lines showed different patterns of internalization and intracellular distribution of cystatin C In the MCF-7 and A-431 cell lines, CLSM demonstrated that internalized cystatin ... can withstand high temperatures without losing their inhibitory activity It showed a concentration of 200 pmol cysteine protease inhibitorÆmg protein)1 To elucidate whether the total cysteine...

12
389
0

Báo cáo khoa học: Superoxide radical-scavenging effects from polymorphonuclear leukocytes and toxicity in human cell lines of newly synthesized organic selenium compounds potx

Ngày tải lên : 23/03/2014, 07:20

... Furthermore, these compounds were not toxic in some human cells and PMNs, indicating that they have the potential to prevent in ammation caused by O2– The next step should be to confirm the antioxidant ... (hypoxanthine–xanthine oxidase system) [38–40] Furthermore, we demonstrated that these compounds not significantly inhibit xanthine oxidase activity [38–40] In the present study, we investigated the anti -in ammatory ... production from PMNs, we investigated the translocation of the molecule to the cell membrane upon stimulation with PMA Figure shows the red fluorescent phallodin staining (F-actin) and the blue...

9
331
0

báo cáo hóa học:" Preclinical evaluation of dasatinib, a potent Src kinase inhibitor, in melanoma cell lines" pptx

Ngày tải lên : 18/06/2014, 15:20

... that dasatinib induces both cell cycle arrest and apoptosis In Lox-IMVI, the most sensitive cell line, treatment with dasatinib induced both apoptosis and cell cycle arrest In the other dasatinib ... sensitive cell lines than in the two resistant cell lines Although the number of cell lines is small, this suggests that EphA2 expression may predict response to dasatinib treatment and warrants further ... combination with chemotherapy The effect of dasatinib in combination with chemotherapy was examined in the three dasatinib responsive cell lines, Lox-IMVI, HT144 and Malme-3M and in one of the dasatinib-resistant...

11
476
0

Báo cáo sinh học: " Inhibition of phosphorylated c-Met in rhabdomyosarcoma cell lines by a small molecule inhibitor SU11274" pdf

Ngày tải lên : 18/06/2014, 19:20

10
402
0