... of “geographical provinces” or “areas of characterization.” The continental areas at the date of man’s appearance on the earth Eurafrica, Austafrica, Asia, America, Oceanica Causes and consequences ... works Nearly all the individual works inthe collection are inthe public domain inthe United States If an individual work is inthe public domain inthe United States and you are located inthe ... institution for teaching Anthropology must have a Laboratory attached to it; andin that Laboratory the best part of the work will be done Such a Laboratory will naturally be divided into two departments;...
... areas of Serbia, Bosnia, Croatia, Bulgaria and Romania BEN is clinically and morphologically very similar to AAN; indeed, AA-specific DNA adducts have been detected in BEN patients andin individuals ... mutagens and potential human carcinogens identified in diesel exhaust and ambient air pollution [69–71] Indeed, 3-NBA induces squamous cell carcinoma in rat lung after intratracheal administration ... E Kucab et al Investigating human cancer aetiology usingthe HUF immortalization assay Thus far, four environmental carcinogens have been examined usingthe HUF immortalization assay: (a) UV...
... paracrine inflammatory networks has become increasingly appreciated in recent years Inthis capacity astrocytes likely respond to neural damage, infection, or tumorigenisis in such a way as to ... Dynamics, Sunnyvale CA) and bands quantified using instrument-resident densitometry software (ImageQuant™, Molecular Dynamics) Within each sample, the density of each apoptosis-associated mRNA ... elicits a fundamental influence upon multiple gene regulatory pathways excitotoxins (eg quinolinic acid) and other paracrine factors that might injure neaby neurons [29] Research ongoing in our laboratory...
... necessarily having the knowledge or training to address the stroke risk factor modification, we provided standard training and education regarding patient motivational interviewing and goal setting ... and services within the VA; better education tothe providers regarding risk factors and warning signs; and improved administrative support A summary of the emergent themes is available in Table ... endorsed the idea that they have a role in secondary stroke risk factor management (81% in Indianapolis and 100% in Houston) However, there was a disparity inthe extent and delivery manner of this...
... under-represented inthe Baerenfaller set, and; (ii) AS events were over- represented in both the Castellanaand the Merged set Baerenfaller and Castellana sets Comparison tothe same fraction calculated for the ... under-represented inthe experimental proteomics datasets, is the most plausible A key factor that might explain the over- representation of AS events inthe Castellana set compared tothe Baerenfaller set, involves ... confirmed usingthe latter set (Table 2) Comparison of the AS loci revealed that seven AS loci had confirmed AS events in both the Castellana- and Baerenfaller sets In total, 60 AS events corresponding...
... IN is similar to that of HIV-1 IN; and it is organized in C- and N- terminal domains, anda catalytic core domain (CCD) The C-terminal domain is likely to be involved in target (i.e., cellular) ... were in Ramachandran-favored position and 5% were in Ramachandran-allowed positions [see Additional file 1] When HIV-1 and FIV IN CCD structures were superimposed, all amino acids facing the catalytic ... http://www.retrovirology.com/content/4/1/79 A increasing aa similarity B C Figure Proposed binding mode of integrase strand transfer inhibitors (INSTIs) to FIV integrase Proposed binding mode of integrase strand transfer inhibitors (INSTIs)...
... Clair streetcar exclusive right‐of‐way, TPA is building new ‘Green P’ lots to make up for some of the lost on‐street parking.) Rather than using observational data, parking capacity and usage data was requested from the Toronto Parking Authority (TPA). Because the TPA now exclusively employs pay and display ... how much they spend inthe area; the purpose of their visit; what form of transportation they use to get tothe area; and their preference for a bike lane or a wider sidewalk. Again, pedestrians were also asked about widening the sidewalk, as an alternative to installing a bike ... The spending habits of cyclists and pedestrians, their relatively high travel mode share, andthe minimal impact on parking all demonstrate that merchants inthis area are unlikely to be negatively affected by reallocating on‐street parking space toa bike lane. On the contrary, this ...
... (5¢-GAT AAAACCACACCTGTAGTAGCTG-3¢) and MCAD 116 5A G (5¢-CCTGTAGAAAGACTAATGAGGGATG CC-3¢) (mutagenic substitutions are shown in bold), andthe antisense primer (5¢-GTAACGCCAGGGTTTTCCCA GTCAC-3¢) ... over increasing temperature (A) This shows the thermostability as determined by the ferricenium assay after a 10-min incubation at the temperature indicated (error bars ¼ standard deviation of the ... activity, as the kcat andthe ETF interaction are relatively unaffected This mutation seems to affect mainly the initial folding and stability of the tetramer, and similarly lowered levels of tetramer...
... meaning (D) Considerably lacking in meaning (E) Unable to understand, and unable to imagine the actual utterance Results and Discussions 4.1 Decrease inthe Number of Errors Table 4-1 shows the ... the Error-Pattem-Database and String-Database can be mechanically prepared, which reduces the effort required to prepare the databases and makes it possible to 657 word-class splitting and consecutive ... extracted from the speech recognition results andthe corresponding actual utterances, then they are stored ina database (referred to as an Error-Pattern-Database) In EPC, the correction is made...
... decreases in collagens I, III and X, the catabolic enzymes matrix metalloproteinases (MMPs) andA distintegrin and metalloproteinase with thrombospondin motifs (ADAMTSs) and inflammatory cytokines ... executed the study and helped with data analysis and interpretation including drafting the manuscript All authors read and approved the manuscript Competing interests The authors declare that they have ... growth factor genes, catabolic/anti-catabolic genes and inflammatory/pain genes (Additional file Table S1 and Additional file Table S2) Relative gene expression was calculated usingthe comparative...
... grazing animals, the pasture ineach paddock was sampled on the first and last day of the grazing period andthe larvae were extracted and counted [16] At the same time, grass availability was ... cages This estimate gave acceptable data in 1990, but not in 1992, when the estimated feed availability was too high The dead material inthe pasture in 1992 was not taken into account, leading ... (generation G2) In 1992, half of the lambs from each group were challenged inthe same way as their sires, andthe other half was tested usingthe alternative challenge Mating was intended to produce...
... inter-professional communication and access to patients’ medical information are essential to integrate pharmacists inthe primary care system [20] The role of medical professionals is a dominant factor in ... in defining, controlling and scoping the work of the allied health professionals [21,22] as extending pharmacists’ role in primary care may affect the autonomy and control of the medical professionals ... (SPSS Inc., Chicago, IL, USA), separately for western and Chinese medicine Our data analysis Analysis of THS data were conducted without imputation of missing data We focused our multivariate data...
... research the topic, used both primary data and secondary data: - Finding documents inthe Internet and magazine Overview previous researches which have the same topic Surveying in 100 students in ... audience has the most difficult standard with music, many kinds of music stream are increased, music cover is a typical example Rationale: Nowadays, finding covered songs are so easy, they appear in ... Literature review and Data analysis and discussion In Literature review, the report reviews on previous studies and shows what the achieved points andthe weakness ineach study are After that,...
... beliefs and knowledge, formal curricula, teaching goal and assessment, teacher’s roles, teacher’s approaches and techniques, teaching and learning materials All the examined aspects were analyzed in ... was not the central focus in their teaching They were all ina rush tothe students’ final examination in which pronunciation took an unimportant part The materials for learning and teaching pronunciation ... games that are out of central teaching objectives’ (Hang, aged 40) The teachers developed a wealth of resources for other teaching areas such as grammar and vocabulary They felt that an equally...
... CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA ... TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC ... domain either 5¢ or 3¢ tothe core domain resulted ina similar deadenylation and overall mRNA decay rate [33] The PAI-2 ARE is unusual in that in addition to an auxiliary domain (Fig 7, the atypical...
... the club manager must think I’m a jerk, too. I’m sure he’ll never let me perform there again. I feel like crap. I just can’t stand it. I’m going to get a quart of ice cream and rent a bad movie and crawl into bed.” And here’s the other: “Darn! This is so disappointing. I guess I screwed up by not promoting the gig ... are the activities we turn to when we are afraid, and they serve to distract us from both the fear, andthe guilty knowledge that we are procrastinating. Procrastination has, in fact, an amazing ability to disguise itself: that is one of its most powerful weapons. What ... “starving” seems like such fun andthe artists in these kinds of works always seem to find someone to cadge a good meal off of, anyway and then, to top it off, the artist frequently later hits the jackpot and achieves professional success. ...
... maintained A big thank you to Deborah Haylett and Finn, Ermias Alemu, Sasha Rozansky and Mahi Salih and Ben Gatty of Islington Metamporhis and Paul Burns of Mind in Harrow for advice, support and so ... based services stated that there wasn’t enough support from the NHS and that they couldn’t provide training to staff or pay them a reasonable wage ‘We can’t cope with demand and are having to ... Improving the asylum processes to make them faster and fairer, and working more with destitute asylum seekers by providing them with accommodation and at the very least basic living standards and access...
... undergraduate and graduate), to teach solar and space physics graduate programs, andto integrate topics in solar and space physics into basic physics and astronomy classes Recommendation: The NSF and ... Recommendation: In collaboration with other interested agencies, the NSF and NASA should take the lead in initiating a program in laboratory plasma science that can provide new understanding of fundamental ... of the data for operational use.4 Recommendation: NASA and NOAA should initiate the necessary planning to transition solar and geospace imaging instrumentation into operational programs for the...
... were almost perfectly collinear (the shares of other assets in total assets were constant) Instead, we use the share of cash and central bank balances in total assets The share of loans inthe banks’ ... foreign assets are separated) as well as the balance sheet total On the assets side, it can be seen that the shares of cash and central bank balances, interbank claims and loans (despite rising loans ... Openness andthe share of non-interest income in total income Openness (the share of the sum of foreign assets and liabilities inthe balance sheet total) andthe ratio of non-interest income to total...
... authorities inthe study area and were linked toa digital map of all roads inthe Netherlands (NWB), using GIS Other land use data were obtained from a European land use database (CORINE) Supervised ... within range of the original database [20] Correlation between modeled NO -concentration and distance tothe nearest main road was high (Spearman’s r: -0.88) Distance tothe nearest main road and ... towns or villages within these municipalities, the highways (provincial roads) adjacent tothe area andthe nearest freeway, which is located tothe west of the study area The circle within the...