do not separate two predicates with a comma unless the comma has a valid function

Báo cáo toán học: "On the Generalized Convolution with a Weight - Function for Fourier, Fourier Cosine and Sine Transforms" pot

Báo cáo toán học: "On the Generalized Convolution with a Weight - Function for Fourier, Fourier Cosine and Sine Transforms" pot

Ngày tải lên : 06/08/2014, 05:20
... Russian) V A Kakichev and Nguyen Xuan Thao, On the design method for the generalized integral convolution, Izv Vuzov Mat (1998) 31–40 (in Russian) V A Kakichev and Nguyen Xuan Thao, On the generalized ... convolution with a weightfunction for the Cosine - Fourier integral transform, Acta Math Vietnam 29 (2004) 149–162 15 Nguyen Xuan Thao and Nguyen Thanh Hai, Convolution for Integral Transforms and Their ... Their Application, Russian Academy, Moscow, 1997 16 Nguyen Xuan Thao and Trinh Tuan, On the generalized convolution for I transform, Acta Math Vietnam 28 (2003) 159–174 17 M Saigo and S B Yakubovich,...
  • 16
  • 336
  • 0
Báo cáo y học: "HTLV-1 Tax mutants that do not induce G1 arrest are disabled in activating the anaphase promoting complex" pdf

Báo cáo y học: "HTLV-1 Tax mutants that do not induce G1 arrest are disabled in activating the anaphase promoting complex" pdf

Ngày tải lên : 13/08/2014, 05:22
... pathway Whether the IKK/NF-κB pathway may share a common Tax-targeted regulatory factor with the cell cycle/APC pathway remains to be seen S cerevisiae-viable tax mutants are attenuated in APC/C ... cerevisiae-viable tax mutants are attenuated in APC/C activation S cerevisiae-viable tax mutants are attenuated in APC/C activation (A) KY630 cells carrying a gene encoding CLB23XHA integrated at the ... ubiquitin-mediated degradation of the CDK inhibitor p27 Nat Cell Biol 1999, 1:193-199 Nakayama K, Nagahama H, Minamishima YA, Matsumoto M, Nakamichi I, Kitagawa K, Shirane M, Tsunematsu R, Tsukiyama T,...
  • 12
  • 302
  • 0
How do China and Brazil deal with water pollution challenges? A comparative perspective of two emerging countries’ approach to water pollution problems docx

How do China and Brazil deal with water pollution challenges? A comparative perspective of two emerging countries’ approach to water pollution problems docx

Ngày tải lên : 15/03/2014, 16:20
... library, online journal databases, as well as other articles and reports available online Data from books, journals, articles, and reports are accordingly cited and quoted All the material has ... development (FAO, 1995) Achieving sustainable agriculture and rural development (SARD) in China and Brazil is not an easy task, as the per capita water availability is falling rapidly Achieving SARD depends ... "the management and conservation of the natural resource base, and the orientation of technological and institutional change in such a manner as to ensure the attainment and continued satisfaction...
  • 36
  • 481
  • 0
báo cáo hóa học:"Medication diaries do not improve outcomes with highly active antiretroviral therapy in Kenyan children: a randomized clinical trial" pot

báo cáo hóa học:"Medication diaries do not improve outcomes with highly active antiretroviral therapy in Kenyan children: a randomized clinical trial" pot

Ngày tải lên : 20/06/2014, 08:20
... Puthanakit T, Oberdorfer A, Akarathum N, Kanjanavanit S, Wannarit P, Sirisanthana T, Sirisanthana V: Efficacy of highly active antiretroviral therapy in HIV-infected children participating in Thailand's ... The diary sheets were in tabular form with the name of each medication appearing in a separate row The caregiver was asked to place a tick mark in an empty box beside the name of the medication ... 24 in the control arm At six months, viral load data were available for 22 children in each arm, and after nine months of HAART, 14 children in each arm had viral load data We compared the proportions...
  • 10
  • 226
  • 0
Báo cáo y học: " Solitary Peutz-Jeghers type hamartomatous polyps in the duodenum are not always associated with a low risk of cancer: two case reports" pptx

Báo cáo y học: " Solitary Peutz-Jeghers type hamartomatous polyps in the duodenum are not always associated with a low risk of cancer: two case reports" pptx

Ngày tải lên : 10/08/2014, 23:21
... a hamartomatous polyp with a focus of well-differentiated adenocarcinoma, and Case was a hamartomatous polyp with Table Twenty-seven cases of solitary duodenal Peutz-Jeghers type hamartomatous ... type hamartomatous polyps and PJS may need to be reexamined Our two cases were diagnosed in patients with an advanced age similar to previous reports, but they differ in the malignant alteration ... interpreted the patient data AT, NF, KS, AT, MT and HI analyzed endoscopic data YS, HT, TK, CT, YA, AN and SM performed the histological examination of the organs YS, MI and SK were major contributors...
  • 4
  • 458
  • 0
Báo cáo y học: "Genetic polymorphism of p53, but not GSTP1, is association with susceptibility to esophageal cancer risk – A Meta-Analysis"

Báo cáo y học: "Genetic polymorphism of p53, but not GSTP1, is association with susceptibility to esophageal cancer risk – A Meta-Analysis"

Ngày tải lên : 25/10/2012, 11:40
... Asian Morita S[29] 1998 Japan Asian van Lieshout EM[30] 1999 The Netherlands Caucasian Tan W&[31] 2000 China Asian Lee JM[22] 2000 China(Taiwan) Asian Casson AG[21] 2003 Canada Caucasian Roth MJ[32] ... 2004 China Asian Casson AG[20] 2006 Canada Caucasian Cai L[25] 2006 China Asian Murphy SJ[33] 2007 Irish Caucasian Canova C[19] 2009 European Caucasian SNP site Sample size HWE MAF Genotypic ORs& ... for the analysis Data Extraction Two investigators independently extracted data and reached a consensus on all of the items Data extracted from these articles included the first author’s name,...
  • 9
  • 615
  • 0
What To Do If Trapped In A Lift With A Dentist

What To Do If Trapped In A Lift With A Dentist

Ngày tải lên : 14/11/2012, 16:50
... robot slaves or a titanium bra I don't have a time machine or a personal dinosaur farm I don't have my meals in a tablet or a bionic arm It's not that we need these things they are not necessary ... are physical matter and abstract concepts and you can't have the latter without the former because ideas only exist in the mind and a mind is only a metaphysical abstraction of a physical brain ... WOULDN'T WANT FOR CHRISTMAS A dead robin in a sock, a relaxation CD that appears to be voiced by Ian Paisley A pair of trainers pickled in bree A vague sense of inadequacy A perambulating hamster nailed...
  • 34
  • 515
  • 0
what can you do with a major in biology real people, real jobs, real rewards (what can you do with a major in...)

what can you do with a major in biology real people, real jobs, real rewards (what can you do with a major in...)

Ngày tải lên : 01/06/2014, 10:54
... years years Math* years years years years Lab Science** years years years years Foreign Language years years years years Academic Electives years years years years * selected from algebra I, algebra ... write a thesis and present an oral defense of that thesis, similar to what Ph.D candidates are required to do, although not original research, as is often required for doctorates As you can see, the ... (scholarships and grants) to lure you to that school ACCESS AND CHOICE The foundation of all student financial aid programs are the two concepts of access and choice They usually go hand-in-hand and...
  • 142
  • 375
  • 0
Báo cáo sinh học: " Panicovirus accumulation is governed by two membrane-associated proteins with a newly identified conserved motif that contributes to pathogenicity" pptx

Báo cáo sinh học: " Panicovirus accumulation is governed by two membrane-associated proteins with a newly identified conserved motif that contributes to pathogenicity" pptx

Ngày tải lên : 19/06/2014, 08:20
... CCTTTCTTATCAGCCACCCTGTAGAG GGAATACAGCTGGCAAGGC TGATCCTGGGCGTATGCGC GCCCCAACTAATGCATTGGTCACTAG CCAAGCAGTCGCATTGGCCCC a The altered nucleotides on the PMV cDNA are underlined mock F1313F2 F31 3A PMV other ... REP/F -A REP/D -A MUTPMV-1236R REP/W -A CCCCAGCGGCTTCGTTCTTTGC GGAACCCCAGCAAACTCGTTCTTTGC CTGTGGGTTTTGCAACCCCAGCG CAGCCAACTGGGCAGCCTCTGTG CTCCAGACAGCCGCCTGGTTAGC CACACCCTGTAGAGGGCTCTCCAG CCTTTCTTATCAGCCACCCTGTAGAG ... had variable symptoms (Y33 0A, C33 5A, D36 3A, and P39 9A) All four of the mutations were stably maintained For example the alanine residue is maintained for Y33 0A cDNA re-isolated from plants that...
  • 12
  • 307
  • 0
báo cáo hóa học:" Thrombospondin-1 serum levels do not correlate with pelvic pain in patients with ovarian endometriosis" doc

báo cáo hóa học:" Thrombospondin-1 serum levels do not correlate with pelvic pain in patients with ovarian endometriosis" doc

Ngày tải lên : 20/06/2014, 07:20
... of the vascular endothelial growth factor and interleukin-8 in ovarian endometriomata Mol Hum Reprod 2000, 6:50-54 Price DD, McGrath PA, Rafii A, Buckingham B: The validation of visual analogue ... the other hand, angiogenic factors have been found increased in ovarian endometriomas [6] Angiogenesis is related to vascularization Therefore, a correlation between vascularization and the presence ... such as antiprostaglandins and requiring bed rest) and/or dyspareunia and/or chronic pelvic pain (n = 26) The degree of pain was established using a visual analogue scale, VAS scale [14] All patients...
  • 3
  • 294
  • 0
Báo cáo lâm nghiệp: "Do trees use reserve or newly assimilated carbon for their defense reactions? A 13 C labeling approach with young Scots pines inoculated with a bark-beetle-associated fungus (Ophiostoma brunneo ciliatum" pptx

Báo cáo lâm nghiệp: "Do trees use reserve or newly assimilated carbon for their defense reactions? A 13 C labeling approach with young Scots pines inoculated with a bark-beetle-associated fungus (Ophiostoma brunneo ciliatum" pptx

Ngày tải lên : 07/08/2014, 16:21
... irradiance with a maximum photon flux density of 200 µmol.m−2 s−1 ) at Champenoux (INRA Nancy, France) All saplings were watered with an automated drip irrigation, and supplied with a slow release ... by the environment and biotic stresses [18] At that stage, the capacity of the tree to respond the fungal spread may rely more on the availability of current assimilates from the foliage [5] Abiotic ... N Guérard et al The capacity of a tree to contain attacks depends on the rapidity with which it synthesizes large amounts of secondary metabolites, which, at least partly, depends on its ability...
  • 8
  • 411
  • 0
Báo cáo y học: "Pollen allergens do not come alone: pollen associated lipid mediators (PALMS) shift the human immue systems towards a TH2-dominated respons" potx

Báo cáo y học: "Pollen allergens do not come alone: pollen associated lipid mediators (PALMS) shift the human immue systems towards a TH2-dominated respons" potx

Ngày tải lên : 08/08/2014, 21:20
... show an enhanced release of the "TH2" chemokine CCL22 The release of CCL17, a chemokine enhanced in atopic ekzema, was not significantly changed as compared to LPS treatment alone At a functional ... extracts and their constituents PALMs potently attract and activate PMN and eosinophils The finding that pollen grains interact with cells of the human immune system was made by Siegel and Sherman as ... pollen-associated lipid mediators When pollen grains are hydrated on the respiratory epithelia, they release allergens and eicosanoid lipids, the so-called pollen-associated lipid mediators (PALMs)...
  • 6
  • 378
  • 0
báo cáo khoa học: "Massive right-sided Bochdalek hernia with two unusual findings: a case report" docx

báo cáo khoa học: "Massive right-sided Bochdalek hernia with two unusual findings: a case report" docx

Ngày tải lên : 10/08/2014, 23:20
... intra-abdominal hypertension Due to the long-standing displacement of various abdominal organs outside the abdominal compartment, there is a decrease in the abdomen’s capacity to accommodate the ... domain and the possible development of abdominal compartment syndrome (ACS), a smaller prosthetic patch was used to close the abdominal fascia to decrease the risk of abdominal hypertension The ... bowel incarceration After 24 hours, our patient was then taken to the operating theater for repair of the hernia Given the size of the defect, the surgical approach was a thoracoabdominal incision...
  • 4
  • 414
  • 0
Báo cáo y học: "Reconstruction of the urethra with a Surgisis onlay patch in urethral reconstructive surgery: two case reports" pdf

Báo cáo y học: "Reconstruction of the urethra with a Surgisis onlay patch in urethral reconstructive surgery: two case reports" pdf

Ngày tải lên : 11/08/2014, 17:21
... urethrotomy using the Sachse technique without complications Two years later, the patient complained again of decreasing urine stream and frequency As shown in Figure 1A, maximal flow was 9.1ml/sec ... urethral stricture was found Biodegradable grafts seem to be an ideal solution for the repair of the urethra as well as other segments of the urinary tract SIS acts like a framework for the host-tissue ... was involved in the clinical follow-up JR participated in the surgery, was involved in the clinical follow-up and supervised this report All authors read and approved the final draft Do you have...
  • 4
  • 292
  • 0
báo cáo khoa học: " Do patients think cannabis causes schizophrenia? A qualitative study on the causal beliefs of cannabis using patients with schizophrenia" pps

báo cáo khoa học: " Do patients think cannabis causes schizophrenia? A qualitative study on the causal beliefs of cannabis using patients with schizophrenia" pps

Ngày tải lên : 11/08/2014, 18:20
... recorded and then transcribed in full Transcripts were compared with tapes by the research team and validated with patients, if necessary Validation of transcripts with patients was necessary in ... analysis was taken to evaluate findings This meant allowing the data to “speak for themselves” rather than approaching the data within existing theoretical frameworks [21] All interviews were tape recorded ... My parents were constantly quarrelling, so I began daydreaming: Everything what happened was just a theatrical play with me becoming merely a facade Because of that I had no chance to relax The...
  • 8
  • 270
  • 0
Báo cáo y học: "Array comparative genomic hybridisation-based identification of two imbalances of chromosome 1p in a 9-year-old girl with a monosomy 1p36 related phenotype and a family history of learning difficulties: a case report" pps

Báo cáo y học: "Array comparative genomic hybridisation-based identification of two imbalances of chromosome 1p in a 9-year-old girl with a monosomy 1p36 related phenotype and a family history of learning difficulties: a case report" pps

Ngày tải lên : 11/08/2014, 19:21
... normal The proband's father was not available for assessment, however it was reported that he had fathered another child of different maternal origin who also displayed growth and developmental ... requested in order to ascertain the origin of this rearrangement A paternal sample was unavailable but FISH analysis of the mother, grandmother and siblings of the proband revealed a normal diploid compliment ... is pregnant with a fourth child of different paternity, and has undergone prenatal diagnosis, the conventional cytogenetic analysis for which has revealed a normal female karyotype aCGH was performed...
  • 6
  • 376
  • 0
Báo cáo khoa học: "Respiratory compliance but not gas exchange correlates with changes in lung aeration after a recruitment maneuver: an experimental study in pigs with saline lavage lung injury" pptx

Báo cáo khoa học: "Respiratory compliance but not gas exchange correlates with changes in lung aeration after a recruitment maneuver: an experimental study in pigs with saline lavage lung injury" pptx

Ngày tải lên : 12/08/2014, 22:22
... manuscript RD participated in the animal experiments and the analysis of data AU participated in the animal experiments and the analysis of multi-slice CT data AM did the radiology studies and ... overall lung compliance Following the argument of Barnas et al [32] that the elastance (E) of the rib cage compartment is parallel to the elastance of the diaphragm-abdomen compartment, the elastances ... dimensionless fractional change for any parameter 'X' was then calculated as fractional change (X) = XpostRM/XpreRM - and correlation analysis performed as explained above Fractional change values are expressed...
  • 12
  • 254
  • 0
Báo cáo y học: "Are serum cytokines early predictors for the outcome of burn patients with inhalation injuries who do not survive" pot

Báo cáo y học: "Are serum cytokines early predictors for the outcome of burn patients with inhalation injuries who do not survive" pot

Ngày tải lên : 13/08/2014, 11:22
... data, reviewed the analysis, and helped to write the manuscript RPM helped to collect data and write the manuscript MGJ designed the study, gathered data, conducted the statistical analyses, and ... PaO2/FiO2 ratio The PaO2/FiO2 ratio was used to quantify the degree of abnormalities in pulmonary gas exchange PaO2/FiO2 ratio was measured in all patients within 24 hours after admission In addition, ... minutes After a wash step, the beads were incubated with the detection antibody cocktail, each bead specific to a single cytokine After an additional wash step, the beads were incubated with streptavidin-phycoerythrin...
  • 8
  • 310
  • 0

Xem thêm