distributed sourcecoding of a single source

Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf

Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf

Ngày tải lên : 22/06/2014, 22:20
... containing solvents are used As it was indicated by Efrima et al [24], Lewis base alkylamine solvents promote the decomposition reaction of metal alkyl xanthates, thiocarbamates and thiocarbonates ... solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band gap for SnS NCs compared with the bulk material can be explained by quantum confinement ... allowed transition with an energy gap of 1.6 eV for the nanocrystalline particles, higher than the literature value (1.1 eV) for bulk films of SnS [30, 31] Calculated the same way band gap value of sub-200...
  • 5
  • 365
  • 0
Báo cáo hóa học: " Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" ppt

Báo cáo hóa học: " Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" ppt

Ngày tải lên : 22/06/2014, 22:20
... containing solvents are used As it was indicated by Efrima et al [24], Lewis base alkylamine solvents promote the decomposition reaction of metal alkyl xanthates, thiocarbamates and thiocarbonates ... solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band gap for SnS NCs compared with the bulk material can be explained by quantum confinement ... allowed transition with an energy gap of 1.6 eV for the nanocrystalline particles, higher than the literature value (1.1 eV) for bulk films of SnS [30, 31] Calculated the same way band gap value of sub-200...
  • 5
  • 276
  • 0
Báo cáo sinh học: " Phenotype and envelope gene diversity of nef-deleted HIV-1 isolated from long-term survivors infected from a single source" pptx

Báo cáo sinh học: " Phenotype and envelope gene diversity of nef-deleted HIV-1 isolated from long-term survivors infected from a single source" pptx

Ngày tải lên : 18/06/2014, 18:20
... placed on a highly active antiretroviral therapy (HAART) regimen of abacavir, nevirapine and zidovidine in January 1999, which suppressed plasma and CSF viral loads to below detectable levels and ... Baba M, Nishimura O, Kanzaki N, Okamoto M, Sawada H, Iizawa Y, Shiraishi M, Aramaki Y, Okonogi K, Ogawa Y, Meguro K, Fujino M: A small-molecule, nonpeptide CCR5 antagonist with highly potent and ... mechanism(s) that are not necessarily associated with changes in coreceptor usage or enhanced replicative capacity in vitro V1V2 and V3 HTA analysis Changes in the dominant viral quasispecies may...
  • 12
  • 401
  • 0
Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf

Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf

Ngày tải lên : 23/03/2014, 07:20
... Collinge AJ (1974) Occlusion of the septal pores of damaged hyphae of Neurospora crassa by hexagonal crystals Protoplasma 80, 57–67 19 Yuan P, Jedd G, Kumaran D, Swaminathan S, Shio H, Hewitt D, Chua ... bodies of N crassa are smaller with an average size of 2934 To corroborate the appearance of hexagonal HEX1 structures in BY4742, this strain was also analyzed by electron microscopy The untransformed ... secondary antibodies applied were obtained from Molecular Probes (Alexa Fluor 594 goat anti-rabbit IgG and Alexa Fluor 488 goat anti-mouse IgG) Acknowledgements We thank F Nargang for the N crassa...
  • 10
  • 350
  • 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Ngày tải lên : 23/03/2014, 13:20
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
  • 11
  • 679
  • 0
báo cáo hóa học: " Psychometric properties of a single-item scale to assess sleep quality among individuals with fibromyalgia" potx

báo cáo hóa học: " Psychometric properties of a single-item scale to assess sleep quality among individuals with fibromyalgia" potx

Ngày tải lên : 18/06/2014, 18:20
... medication up to and including Day1 If fewer than scores are available then baseline consists of all scores that are available Page of (page number not for citation purposes) Health and Quality of ... clinical trials During the baseline phase, study patients had to have an average daily diary pain score of at least (within the last days) on a numeric rating scale ranging from ("no pain") to ... 1056 and 91.0% in study 1077) (Table 1) In study 1056, the mean age of patients was 48.8 years and the average duration of FM was years In study 1077, the mean age of patients was 50.1 years and...
  • 7
  • 597
  • 0
báo cáo hóa học:" Research Article Design and Implementation of a Single-Frequency Mesh Network Using OpenAirInterface" docx

báo cáo hóa học:" Research Article Design and Implementation of a Single-Frequency Mesh Network Using OpenAirInterface" docx

Ngày tải lên : 21/06/2014, 18:20
... channel measurements which can be used for channel characterization and capacity analysis [2] Apart from a general overview of OpenAirInterface, in this paper we present OpenAirMesh a specification ... to transport data traffic corresponding to a particular flow Table 4: Transport and physical channels Each of the transport channels is mapped to a corresponding physical channel of the same name ... the means for exploiting channel state feedback at the transmitters in order to allow for advanced PHY allocation of OFDMA resources via the MAC In addition to the physical channels of Table 4,...
  • 16
  • 768
  • 0
Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc

Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc

Ngày tải lên : 22/06/2014, 00:20
... five Si layers (200 Si atoms) and a *12 A vacuum layer The bottom of the slab has a bulk-like structure with each Si atom saturated by an H atom All atoms except for the H and Si atoms at the bottom ... densities of the clean Si substrate, 19H-Si(111)- and isolated H atoms are calculated with the same lattice parameters and atomic positions as the relaxed Ag adsorbed 19H-Si(111)-7 surface This allows ... the H atoms on the Si surface, we observe that the charge accumulates around the Ag atom, and strongly depletes around the Si adatom, rest atom and the third adjacent Si atom at the second layer...
  • 6
  • 368
  • 0
The Integration of Functions of a Single Variable, by G. H. Hardy pptx

The Integration of Functions of a Single Variable, by G. H. Hardy pptx

Ngày tải lên : 28/06/2014, 19:20
... either algebraical or the sum of an algebraical function and of a finite number of constant multiples of logarithms of algebraical functions All algebraical functions which occur in the integral are ... Integrals of algebraical functions in general 38 11–14 The general form of the integral of an algebraical function Integrals which are themselves algebraical 38 15 Discussion of a particular case 45 ... operations which are always practicable And it has been shown, more generally, that we can always determine by means of such operations whether the integral of any given algebraical function is algebraical...
  • 86
  • 262
  • 1
Báo cáo khoa học: " Persistent occurrence of a single Streptococcus equi subsp. zooepidemicus clone in the pig and monkey population inIndonesia" ppsx

Báo cáo khoa học: " Persistent occurrence of a single Streptococcus equi subsp. zooepidemicus clone in the pig and monkey population inIndonesia" ppsx

Ngày tải lên : 07/08/2014, 18:20
... Isrina Oktavia Salasia et al reactions and with a commercial grouping kit (Slidex Strepto-kit bioMerieux, Nürtingen, Germany) The growth pattern of the bacteria in fluid media and the morphology of ... and with compact colonies in soft agar The growth properties of these three bacteria obtained from the original outbreak had already been described [15] According to studies of Abdulmawjood and ... (Biolabs, Schwalbach, Germany) [1] The preparation and SmaI digestion of the chromosomal DNA for macrorestriction analysis of the isolates by pulsed-field gel electrophoresis was performed as described...
  • 3
  • 314
  • 0
Báo cáo y học: "Vaccination response to tetanus toxoid and 23-valent pneumococcal vaccines following administration of a single dose of abatacept: a randomized, open-label, parallel group study in healthy subjects" pot

Báo cáo y học: "Vaccination response to tetanus toxoid and 23-valent pneumococcal vaccines following administration of a single dose of abatacept: a randomized, open-label, parallel group study in healthy subjects" pot

Ngày tải lên : 09/08/2014, 10:20
... levels Anti-tetanus and anti-pneumococcal (Danish serotypes 2, 6B, 8, 9V, 14, 19F and 23F) antibody titers were measured by ELISA at 14 and 28 days after vaccination by a central laboratory Abatacept ... days after vaccination (μg/ml) 28 days after vaccination (μg/ml) N /A N /A N /A N /A N /A 28.6 (26) Group C (vaccines weeks after abatacept) N /A 12.5 (19) 6.1 (20) Group D (vaccines weeks after abatacept) ... London, UK, and on the procedures of the Department of Pathology, University of Alabama at Birmingham, AL, USA [14] All analyses were carried out at the Center for Vaccine Research and Development,...
  • 11
  • 415
  • 0
Báo cáo y học: "Association of a single nucleotide polymorphism in growth differentiate factor 5 with congenital dysplasia of the hip: a case-control study" ppt

Báo cáo y học: "Association of a single nucleotide polymorphism in growth differentiate factor 5 with congenital dysplasia of the hip: a case-control study" ppt

Ngày tải lên : 09/08/2014, 13:22
... Genet A 2003, 11 7A: 136-142 20 Miyamoto Y, Mabuchi A, Shi D, Kubo T, Takatori Y, Saito S, Fujioka M, Sudo A, Uchida A, Yamamoto S, Ozaki K, Takigawa M, Tanaka T, Nakamura Y, Jiang Q, Ikegawa S: A ... Nishimura G, Kawabata H, Yokoyama H, Yoshida A, Tominaga S, Nagano J, Shimizu A, Wakana S, Gondo Y, Noda T, Shiroishi T, Ikegawa S: A novel dominant-negative mutation in Gdf5 generated by ENU mutagenesis ... Yanamandra N, Goodman FR, Mendoza-Londono JR, Savarirayan R, White SM, Graham JM Jr, Gale RP, Svarch E, Newman WG, Kleckers AR, Francomano CA, Govindaiah V, Singh L, Morrison S, Thomas JT, Warman...
  • 5
  • 443
  • 0
Báo cáo y học: " Carinal surgery: experience of a single center and review of the current literature" potx

Báo cáo y học: " Carinal surgery: experience of a single center and review of the current literature" potx

Ngày tải lên : 10/08/2014, 09:22
... optimal anaesthetic and surgical strategies are to be taken into consideration Anaesthetic strategies Multidisciplinary team approach and close collaboration with the anaesthetist, is required Page ... lobectomy years ago CP: carinal plasty with reinplantation of the right main bronchus to the trachea for Tracheal Sarcoma (TS) or carcinoid tumor A: Alive D:Dead The postoperative mortality was 12.5% ... alignment and drafted the manuscript and VY participated in its design and coordination The authors read and approved the manuscript Author Details 1Cardiothoracic Department, Royal Victoria Hospital,...
  • 7
  • 311
  • 0
báo cáo khoa học: " Simultaneous measurement of sensor-protein dynamics and motility of a single cell by on-chip microcultivation system" pps

báo cáo khoa học: " Simultaneous measurement of sensor-protein dynamics and motility of a single cell by on-chip microcultivation system" pps

Ngày tải lên : 11/08/2014, 00:22
... when bacterium was stimulated by aspartate Dashed lines show bacterial division points after 80 of stimulation by aspartate, localized Tar was diffused completely Then, the aspartate was removed ... bacterial chemotaxis: receptor dimers in signalling arrays Molecular Microbiology 1998, 30:459-466 Manson MD, Armitage JP, Hoch JA, Macnab RM: Bacterial locomotion and signal transduction J Bacteriol ... First, a single bacterium was placed in a microchamber and was isolated in the wheel region to swim along the track by sealing of semipermiable membrane lid onto the microchamber Then, the bacterium...
  • 4
  • 166
  • 0
báo cáo khoa học:" Reliability and validity of a single item measure of quality of life scale for adult patients with cystic fibrosis" pot

báo cáo khoa học:" Reliability and validity of a single item measure of quality of life scale for adult patients with cystic fibrosis" pot

Ngày tải lên : 11/08/2014, 23:22
... scale measure and body image may suggest that adult patients with CF may have adopted a level of negative image (stigma) of the disease in manner that is different from an adaptation to physical ... feasibility of administration the testretest reliability and the validity of a single- item global quality of life scale We also examined the relationship of the single item global quality of ... quality of life scale: ‘this must be balanced against the practicality of ascertaining such information Brevity may come at a cost of detail.’ [16] Clinical implication We believe that the single...
  • 8
  • 206
  • 0
Báo cáo khoa học: " Phylogenetic studies reveal existence of multiple lineages of a single genotype of DENV-1 (genotype III) in India during 1956–2007" pdf

Báo cáo khoa học: " Phylogenetic studies reveal existence of multiple lineages of a single genotype of DENV-1 (genotype III) in India during 1956–2007" pdf

Ngày tải lên : 12/08/2014, 04:21
... AMV-RT, and respective sense and antisense primers [(D1: 5'-TCAATATGCTGAAACGCGCGAGAAACCG-3') (D2: 5'-TTGCACCAACAGTCAATGTCTTCAGGTTC-3')] [26] in a thermal cycler (BioRad, USA) The thermal profile of ... Southeast Asian J Trop Med Public Health 2001, 32:326-35 Kukreti H, Chaudhary A, Rautela RS, Anand R, Mittal V, Chhabra M, Bhattacharya D, Lal S, Rai A: Emergence of an independent lineage of dengue ... East Asian countries viz Cambodia, Vietnam, Thailand and Singapore; recent isolates from China and very old strain from Japan (Japan 43 Mochizuki strain) are the only strains from North Asia...
  • 9
  • 464
  • 0
Báo cáo khoa học: " Risk Factors for High Endoparasitic Burden and the Efficiency of a Single Anthelmintic Treatment of Danish Horses" doc

Báo cáo khoa học: " Risk Factors for High Endoparasitic Burden and the Efficiency of a Single Anthelmintic Treatment of Danish Horses" doc

Ngày tải lên : 12/08/2014, 15:20
... aim of validating the questionnaire (Lendal et al 1998) Data analysis Initially bivariate analyses were performed, and variables having p-values below 0.15 were included in the multivariate analysis ... M Larsen et al be an indication that AR has developed Some parasites survive treatment, what facilitates selection of AR parasites (Prichard 1994) This makes it necessary to investigate the association ... estimation The confidence interval of the estimates was based on Wald’s statistics Efficiency of a single anthelmintic treatment The bivariate and the multivariate regression analyses were based...
  • 8
  • 294
  • 0
Báo cáo y học: " Mixed infection and clonal representativeness of a single sputum sample in tuberculosis patients from a " docx

Báo cáo y học: " Mixed infection and clonal representativeness of a single sputum sample in tuberculosis patients from a " docx

Ngày tải lên : 12/08/2014, 16:20
... study, participated in its design, co-ordination and evaluation of data, and helped in drafting the manuscript All authors read and approved the final manuscript Additional material Additional File ... among hospitalised TB patients [12] Demographic data, including sex, age as well as date of diagnosis, clinical diagnosis, and treatment history, were obtained by review of medical and laboratory ... the analysis (Figure 1) All the study subjects were male, and the median age of the 198 patients with available age was 30 years (range, 20 to 63 years) Of these, 134 patients were new cases and...
  • 10
  • 403
  • 0
Báo cáo khoa học: "Effect of a single acupuncture treatment on surgical wound healing in dogs: a randomized, single blinded, controlled pilot study" pps

Báo cáo khoa học: "Effect of a single acupuncture treatment on surgical wound healing in dogs: a randomized, single blinded, controlled pilot study" pps

Ngày tải lên : 12/08/2014, 18:22
... the evaluating veterinarian All wounds were photographed with a digital camera right after the surgery and at the time of the evaluations Statistical analysis A statistical power analysis based ... ECVA, CVA) is working at the Department of Veterinary Surgery and Anaesthesiology of the School of Veterinary Medicine and Animal Science of São Paulo State University in Saarto et al Acta Veterinaria ... part of her post graduation program studies at the School of Veterinary Medicine and Animal Science of São Paulo State University in Brazil as an exchange post graduate student She is also a...
  • 6
  • 383
  • 0

Xem thêm