difference between objective c and c programming

The 10 Most Significant Differences between C# and C++

The 10 Most Significant Differences between C# and C++

Ngày tải lên : 04/10/2013, 21:20
... 135 wrapper class, 342 WriteLine() command, as function call, 74, 160 writing code, CD115–CD119 collection class, CD61–CD71 constant, CD6 forms code, CD175–CD179 generic code, 348–349 generic collections, ... 196 responding to, CD21–CD22 throwing, CD17–CD19 Exception class creating own, CD13–CD15 overriding, CD22–CD26 exception mechanism example of, CD10–CD13 overview of, CD9–CD10 exclamation point (!) operator, ... 110 StreamReader, CD50–CD54 StreamWriter, CD45–CD50 String, 187 structure compared to, 327 wrapper, 342 class constructor, 235–236 class function, 128 class inheritance, 219 class library, CD27, CD29, CD39–CD43 393 Index 28_597043...
  • 35
  • 471
  • 0
Programming Embedded Systems in C and C ++ docx

Programming Embedded Systems in C and C ++ docx

Ngày tải lên : 17/03/2014, 13:20
... delay(unsigned int nMilliseconds) { #define CYCLES_PER_MS 260 /* Number of decrement -and- test cycles. */ unsigned long nCycles = nMilliseconds * CYCLES_PER_MS; while (nCycles ); } /* delay() ... delay() */ The hardware-specific constant CYCLES_PER_MS represents the number of decrement -and- test cycles (nCycles != 0) that the processor can perform in a single millisecond. To determine this ... of Chapter 6 through Chapter 10 and discusses advanced topics that are of interest to inexperienced and experienced embedded programmers alike. These chapters are mostly self-contained and can...
  • 187
  • 924
  • 1
Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf

Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf

Ngày tải lên : 22/03/2014, 21:20
... AAACATATGCTATATTACAATAAAA GG; 2.2up, AAACATATGTTATCTATCGTTGTAAAGC; 2.3up, AA ACATATGCTTGTTCCTCAAAAACTTCC; 3.3rv, AAACTCGAGGACCTTAGCCGTAGTCTTCAC; 3.2rv, AAACTCGAGTTTTCCATTCAAAACCGTG. Construction of site directed mutants The ... CD D3 CD D3 CD + D3 + CD D3 CD + D2 CD + D2 CD + CD-D123 CD-St2.1 CD-St2.2 CD-St2.3 CD+D123 CD+D23 CD+D3 CD+D2 CD+D1 CD + St2.1 CD + St2.2 CD + St2.3 CD + St3.3 CD + St3.2 D1 D2 D3 CD CD-D123W366A x W366A D1 ... Luis Burgos [Comision de Investigaciones Cientificas (CIC)] for excellent techni- cal assistance and Dr Marı ´ a Corvi for helpful discus- sions and critical reading of the manuscript. This work was...
  • 13
  • 457
  • 0
Secure Programming Cookbook for C and C++: Recipes for Cryptography, Authentication, Input Validation & More pot

Secure Programming Cookbook for C and C++: Recipes for Cryptography, Authentication, Input Validation & More pot

Ngày tải lên : 30/03/2014, 03:20
... from access( ) indicates that access will be granted. The problem is that between the time the access check via access( ) completes and the time open( ) begins (both system calls are atomic within ... These race conditions occur when access is checked before opening a file. The most common way for this to occur is to use the access( ) system call to verify access to a file, and then to use open( ... Security, Privacy, and Commerce Database Nation Building Secure Servers with Linux Security Books Resource Center security.oreilly.com is a complete catalog of O’Reilly’s books on security and...
  • 792
  • 4.7K
  • 3
visual c++ and mfc programming

visual c++ and mfc programming

Ngày tải lên : 31/05/2014, 13:48
... Click Exercise1View.cpp and click Open 4. To open another file, on the Standard toolbar, click the Open button 5. Click Exercise1.rc 6. Click the arrow of the Open As combo box and select ... the default CObject constructor is available and gives you access to the CObject methods. CObject(const CObject &Src): If you want to copy a variable of your CObject derived class to use ... of the CObject class are: CObject(): This constructor allows you to use an instance of CObject. If you have created a class based on CObject, when you declared an instance of your object, the...
  • 739
  • 513
  • 0
Program C Ansi Programming Embedded Systems in C and C++ phần 1 doc

Program C Ansi Programming Embedded Systems in C and C++ phần 1 doc

Ngày tải lên : 05/08/2014, 10:21
... the Arcom board processors, and microwave ovens), living rooms (televisions, stereos, and remote controls), and workplaces (fax machines, pagers, laser printers, cash registers, and credit card ... overnight success, and its use increased steadily over the next decade. Early embedded applications included unmanned space probes, computerized traffic lights, and aircraft flight control systems. ... real machines. Few popular high-level languages can compete with C in the production of compact, efficient code for almost all processors. And, of these, only C allows programmers to interact with...
  • 15
  • 451
  • 1
Program C Ansi Programming Embedded Systems in C and C++ phần 3 ppt

Program C Ansi Programming Embedded Systems in C and C++ phần 3 ppt

Ngày tải lên : 05/08/2014, 10:21
... 0x34) #define T0CON (PCB_BASE + 0x36) #define T1CNT (PCB_BASE + 0x38) #define T1CMPA (PCB_BASE + 0x3A) #define T1CMPB (PCB_BASE + 0x 3C) #define T1CON (PCB_BASE + 0x3E) #define T2CNT (PCB_BASE + 0x40) #define ... Macintosh computers -and the ubiquitous 80x86 families. A microcontroller is very much like a microprocessor, except that it has been designed specifically for use in embedded systems. Microcontrollers ... are connected to the processor. Each chip-select register is associated with a single "chip enable" wire that runs from the processor to some other chip. The association between particular...
  • 13
  • 371
  • 2
Program C Ansi Programming Embedded Systems in C and C++ phần 4 potx

Program C Ansi Programming Embedded Systems in C and C++ phần 4 potx

Ngày tải lên : 05/08/2014, 10:21
... Cyclic Redundancy Codes A cyclic redundancy code (CRC) is a specific checksum algorithm that is designed to detect the most common data errors. The theory behind the CRC is quite mathematical and ... memory chip problem you could encounter is a catastrophic failure. This is usually caused by some sort of physical or electrical damage received by the chip after manufacture. Catastrophic failures ... To change to the CRC16 standard, simply change the values of the three constants. For CRC32, change the three constants and redefine width as type unsigned long. /* * The CRC parameters. Currently...
  • 12
  • 427
  • 2
Tài liệu Debugging C and C++ code in a Unix environment ppt

Tài liệu Debugging C and C++ code in a Unix environment ppt

Ngày tải lên : 21/01/2014, 06:20
... Using the compiler’s features. Explicit storage allocation and deallocation In C and C ++ , you have to explicitly allocate and deallocate dynamic storage through malloc and free (for C) and through ... allocation debugging tools As discussed earlier in the section called C and C ++ speci c problems, one of the causes of problems with C and C ++ code, is the policy of requiring explicit allocation ... detecting a number of basic semantic problems such as type mismatches and dead code. For gcc (the GNU C compiler) there are a number of options that affect what static analysis gcc does and what...
  • 29
  • 466
  • 1
Secure Coding in C and C++ pdf

Secure Coding in C and C++ pdf

Ngày tải lên : 08/03/2014, 11:20
... 34 Dueling Containers in C+ + vector<Shape *> pic; pic.push_back( new Circle ); pic.push_back( new Triangle ); pic.push_back( new Square ); … list<Shape *> picture; picture.push_back( pic[2] ... delete the objects to which the pointers refer. vector<Shape *> pic; pic.push_back( new Circle ); pic.push_back( new Triangle ); pic.push_back( new Square ); // leaks memory when pic goes out ... 49 realloc(p, 0) The realloc() function deallocates the old object and returns a pointer to a new object of a specified size. If memory for the new object cannot be allocated, the realloc() function...
  • 135
  • 4.6K
  • 0
Developing and Porting C and C++ Applications on Aix pdf

Developing and Porting C and C++ Applications on Aix pdf

Ngày tải lên : 17/03/2014, 13:20
... Relationship between a process and a user thread . . . . . . . . . . . . 276 xii Developing and Porting C and C+ + Applications on AIX Chapter 1. C and C+ + compilers 23 1.4 Activating the compilers Once ... rights reserved. 1 Chapter 1. C and C+ + compilers This chapter focuses on the latest versions of the IBM C and C+ + compiler products for AIX: C for AIX Version 6.0 and VisualAge C+ + for AIX Version ... licensed product supplies a simple nodelock license certificate. Both the C for AIX Version 6.0 and VisualAge C+ + for AIX Version 6.0 compiler products supply a simple nodelock license certificate. The...
  • 546
  • 2.6K
  • 0
Jim ledin   embedded control systems in c and c++  an introduction for software developers using MATLAB 2004

Jim ledin embedded control systems in c and c++ an introduction for software developers using MATLAB 2004

Ngày tải lên : 19/03/2014, 14:09
... performance specifications. Performance specifications guide the design process and provide the means for determining when a controller design is satisfactory. Controller performance specifications can ... orders, please contact: CMP Books Distribution Center, 6600 Silacci Way, Gilroy, CA 95020 email: <cmp@rushorder.com>; Web: www.cmpbooks.com ISBN: 1-57820-127-6 This document was created by ... proportional controller and K p = 1. This controller produces an unstable (growing amplitude) oscillation and is clearly unacceptable. This document was created by an unregistered ChmMagic, please...
  • 268
  • 2.4K
  • 0

Xem thêm