development of the forest nursery manual a synthesis of current practices and resear pdf
Báo cáo y học: "The in vivo expression of actin/salt-resistant hyperactive DNase I inhibits the development of anti-ssDNA and anti-histone autoantibodies in a murine model of systemic lupus erythematosus" ppt
Ngày tải lên :
09/08/2014, 07:20
... units (AEU) relative to a standard positive sample that was assigned a value of 100 AEU The data are presented as mean ± standard error of the mean Statistics were performed comparing autoantibody ... purposes) Arthritis Research & Therapy Vol No Manderson et al Figure lands) with an excitation wavelength at 485 nm and an emission wavelength at 520 nm Statistics The data are presented as mean ± standard ... in the level of circulating DNA was observed in ash.DNase I transgenic mice These data demonstrate that the therapeutic use of a recombinant actin-resistant, salt-resistant and hyperactive DNase...
- 11
- 558
- 0
The Biopsychosocial Formulation Manual A Guide for Mental Health Professionals docx
Ngày tải lên :
06/03/2014, 02:20
... Although trainees read the standard textbooks and study the Diagnostic and Statistical Manual of Mental Disorders (DSM), the process of organizing the patient data in a meaningful way and marrying ... in the initial collection and organization of patient data and in the process of crafting the data into a biopsychosocial formulation The manual is not meant to take the place of a comprehensive ... counterproductive Creation of a Psychodynamic Database The creation of a psychodynamic database will facilitate the development of a psychological formulation from a developmental perspective (Table 3.6)...
- 178
- 518
- 0
Báo cáo khoa học: The propeptide in the precursor form of carboxypeptidase Y ensures cooperative unfolding and the carbohydrate moiety exerts a protective effect against heat and pressure pot
Ngày tải lên :
07/03/2014, 21:20
... Isolation and physicochemical properties of yeast proteinase A and C Agric Biol Chem 31, 357–367 Aibara, S., Hayashi, R & Hata, T (1971) Physical and chemical properties of yeast proteinase C Agric ... and an a- helix rich domain on the right side Thermodynamic properties of CPY and proCPY Thermodynamic parameters were calculated based on Eqns (2–6) to compare qualitatively the temperature and ... or was obtained from Oriental Yeast Co (Lot 21003805) (Osaka, Japan) and proCPY was prepared as the same manner as CPY, with minor modifications Dgly CPY and Dgly proCPY, in which the asparagine...
- 7
- 439
- 0
THE SUSTAINABLE DEVELOPMENT OF TREE CROPS AND THE PREVENTION OF VEGETATION FIRES IN SOUTH SUMATRA, INDONESIA pptx
Ngày tải lên :
08/03/2014, 10:20
... teknik tanpa sama sekali atau pembatasan jumlah pembakaran disarankan sebagai cara terbaik dalam pembukaan lahan Hampir seluruh perusahaan dan perkebunan rakyat menganggap cara ini sangat mahal dan ... hutan dan perkebunan karena dengan demikian diharapkan akan menyediakan hak akan lahan mereka Perubahan besar dalam tata guna lahan pada awalnya bermula di Sumatera Selatan bila dibandingkan ... kebakaran dan pada saat bersamaan menambah penghasilan adalah dengan menambah bantuan keuangan kepada perkebunan rakyat yang menanam karet jenis klon tetapi mendapat kesukaran dalam merawatnya...
- 77
- 521
- 0
The Development of Religious Liberty in Connecticut pdf
Ngày tải lên :
17/03/2014, 20:20
... passed away, partly because of lack of fit candidates, partly because of the kinship of the two offices of pastor and teacher, and partly because of the heavy expense in supporting both, the office ... and care of every Church and provide and assign allotments of land for the maintenance of each of them." [22] The State, accepting the same view of caretaker, carried its supervision still farther ... seal, and have, for the main, one and the same heart guided by one and the same Spirit of truth," and that they should bend their hearts and forces to the furthering of the work for which they...
- 186
- 584
- 0
Báo cáo khoa học: Tec family kinases: Itk signaling and the development of NKT ab and cd T cells potx
Ngày tải lên :
28/03/2014, 22:21
... development at the initial stages of maturation [28], and both mice deficient in Itk and those that express a transgene for PLZF have a developmental block in stage of iNKT cell maturation, all of which ... TCRmediated Ca2+ influx and activation of PLCc1, weakening downstream signals, such as ERK ⁄ MAPK, NFAT and activator protein-1 [54] Thus the Itk deficiency may decrease TCR signal strength and allow ... context of the nonclassical major histocompatibility complex molecule CD1d [15] Because of current technical difficulties in the isolation and analysis of other NKT cell subsets and their comparatively...
- 10
- 454
- 0
Risk Factors Affecting the Development of Tuberculosis Infection and Disease in Household Contacts of Patients with Pulmonary Tuberculosis pptx
Ngày tải lên :
29/03/2014, 03:20
... total diameter of the cavities was more than cm or sum of the homogen lesions was more than 1/3 of one lung area or sum of the dispersed infiltrations was more than a lung area Statistical Analysis ... upper lateral region of the left forearm for TST and induration diameter was read 72 hours later For standardization of test the same person interpreted it The interpretation of TST reaction was ... characteristics of the contacts were shown in table The mean age of contacts determined active disease was 24.4 ± 16.9 Twenty-one of them were female and 14 male The mean age of index cases was 33.8 ±...
- 4
- 549
- 0
THE EXPOSURE OF YOUTH TO UNWANTED SEXUAL MATERIAL ON THE INTERNET: A National Survey of Risk, Impact, and Prevention pdf
Ngày tải lên :
29/03/2014, 19:20
... at the level of more than a little or all the time during the days right after the incident happened In another series of bivariate analyses, few of the characteristics of the youth, their patterns ... software) and incidents of exposure Longitudinal and qualitative research, along with the use of standardized measures, will be useful to tap into these details and help separate sequences of ... this realm of activity have not been standardized or validated, and this study did not use measures that had been evaluated or validated in other research and, thus, may be flawed by as yet unrecognized...
- 29
- 529
- 0
Báo cáo hóa học: " Research Article Development of Long-Range and High-Speed Wireless LAN for the Transmission of Telemedicine from Disaster Areas" pdf
Ngày tải lên :
22/06/2014, 06:20
... rate Figure 4: An installation example of a parabolic antenna and a wireless LAN unit to a steal pipe Because these units are so easy to transport, set up, and operate, they can be installed and ... unit and a telephone set The difference is that the video transmitter has a special antenna with a shape of a gun, and that a cable connecting between the antenna and the case, a wireless LAN unit ... mitigating the damage of the earthquake and to reinforce the rescue measures for victims Masayuki Nakamura et al Relay station (e) Yakushi Park km WLAN Main drill site WL AN (a) Elderly care...
- 13
- 318
- 0
the professional development of teachers practice and theory
Ngày tải lên :
06/07/2014, 15:32
... that those standards are maintained So, the raising and maintenance of educational standards is a continuous quest, and the central players in that quest must be the teachers “Educational change ... capacities (and capabilities) fell far short of the demands of the rapidly expanding system Thus the achievement of educational expansion came at the cost of years of emergency training of teachers, ... continual monitoring by the national team of national and provincial workshops to maintain quality and guard against the classic dilution effects which beset standard cascade models The feedback...
- 219
- 336
- 0
Báo cáo khoa học: " Effect of IP3 and ryanodine treatments on the development of bovine parthenogenetic and reconstructed embryos" ppsx
Ngày tải lên :
07/08/2014, 15:20
... S., Shirakawa, H., Natada, K and Honda, Y Essential role of the inositol 1,4,5-trisphosphate receptor/Ca2+ release channel in Ca2+ waves and Ca2+ oscillations at fertilization of mammalian eggs ... plasma membranes cause the destabilization of the phospholipid bilayer, which results in the formation of temporary pores in the plasma membrane, thus allowing an exchange of extracellular and ... rate of development with IP3 alone These results indicate that the administration of IP3 and ryanodine by microinjection, may play a role in the mobilization of Ca2+ stores, and affect the developmental...
- 7
- 349
- 0
Báo cáo khoa học: "Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes" ppt
Ngày tải lên :
12/08/2014, 04:21
... biological characterizations JN carried out the molecular characterizations of PVM isolates HX designed and coordinated the study and carried out the genetic analysis All authors read and approved the ... (Reverse: TGAGCTCGGGACCATTCATAC) and PVM4 (Forward: ACATCTGAGGACATGATGCGC) were used in RT-PCR and real-time RT-PCR to yield an amplicon of 520 bp First strand cDNA synthesis was carried out using ... PVM3 and PVM4, a NcoI site was revealed in PVM isolates detected in Germany, Italy, Russia, Poland and China, but not found in the isolates detected in the US (Idaho strain) and Canada (data not...
- 7
- 452
- 0
Báo cáo y học: " Risk factors for the development of nosocomial pneumonia and mortality on intensive care units: application of competing risks models" ppt
Ngày tải lên :
13/08/2014, 08:21
... can take the time-dependency of risk factors and competing events into account ticipated in collecting of the data MW, JB and MS participated in the statistical analysis of the data RPV, PG and ... following Additional files are available online: Additional file Additional file contains information on the required data format and SAS and R calculations for cause-specific hazard ratios in a competing ... HR participated in interpreting the data and drafting of the manuscript All authors read and approved the final manuscript Page of (page number not for citation purposes) Additional files The...
- 9
- 331
- 0
Báo cáo y học: " Evolution of the HIV-1 envelope glycoproteins with a disulfide bond between gp120 and gp41" pdf
Ngày tải lên :
13/08/2014, 13:20
... (see the text) was passaged onto × 106 fresh MT-2 T cells in the presence or absence of 0.3 mM BME and virus spread was measured for 10 days the rate of appearance of syncytia and CA-p24 antigen ... in the study JPM participated in the study design and coordination BB supervised the study, and participated in its design and coordination All authors read and approved the final manuscript Acknowledgments ... replicated with a delay of approximately days compared to the wt virus Replication of the Q591L mutant was significantly better, with a delay of only one day compared to the wt virus Of note is that...
- 11
- 393
- 0
Báo cáo y học: " The impact of IL-1 modulation on the development of lipopolysaccharide-induced cognitive dysfunction." pdf
Ngày tải lên :
13/08/2014, 20:22
... administration caused a permanent retrograde amnesia at both days and (Figure 5) Discussion These data show that a sustained inflammatory challenge leads to neuroinflammation, microglial activation and ... normal by day Data are expressed as mean ± standard error of the mean (n = 6) and compared by one-way analysis of variance and Student-Newman-Keuls method LPS-induced microglial activation is modified ... (GraphPad Software, San Diego, CA, USA) The results are expressed as mean ± standard error of the mean Data were analyzed with analysis of variance followed by Newman-Keuls post hoc test wherever appropriate...
- 9
- 345
- 0
Báo cáo y học: " Analysis of 14 BAC sequences from the Aedes aegypti genome: a benchmark for genome annotation and assembly" docx
Ngày tải lên :
14/08/2014, 07:21
... genome has yielded a set of manually annotated transcripts that has been validated with molecular and comparative data In addition, we have presented data that may clarify the origin of duplicated ... transposon ORFs There were a total of 51 manual annotations (Table 2) among the 14 BAC sequences, with BAC2 having no annotated transcripts Fifty of 51 manual annotations were found in the Ae aegypti ... Issue 5, Article R88 Lobo et al This set of manually annotated transcripts enables a quality check of the Aedes genome auto-annotation Approximately 12% of the manually annotated transcripts...
- 12
- 320
- 0
Báo cáo y học: "Meeting the challenges of drug discovery: a multidisciplinary re-evaluation of current practices" pptx
Ngày tải lên :
14/08/2014, 14:21
... years reviews Finally, John Maraganore (Alnylam Pharmaceuticals, Cambridge, USA) discussed therapeutic applications of RNAi, as exemplified by an siRNA-based agent against respiratory syncytial ... chemogenomics database that incorporates information from animal studies, gene-expression profiling, in vitro assays and literature sources The power of the method was illustrated by the identification and ... with the aim of establishing tissue- and serum-based markers for both diagnostics and functional classification of disease He described the capture of cell-surface proteins via biotinylation...
- 3
- 244
- 0
RESEARCH ON THE GROWTH AND DEVELOPMENT OF TARO VARIETIES AND CULTIVATION TECHNIQUES FOR THE POTENTIAL VARIETY IN YEN BAI PROVINCE
Ngày tải lên :
06/10/2014, 11:46
... such as Giant Taro in forest (Alocasia macrorrhira), Swamp Taro (Cyrtosperma chamissonis), Tannia (Xantosoma agittifolium), Elephant Ear-Giant (Colocasia gigantea ), taro (Colocasia esculenta var ... time ago, the large area of unused land with mainly in single-crop Riceland (passived irrigation) and lowland, which have been the theory of taro planted area expansion 1.2 The origin, classification ... Bai, Ha Giang and Bac Kan In particular, there is almost no study of taro on a number of different types of land including: single-crop land and lowland in the river bank Therefore, the study of...
- 27
- 552
- 0
WNT signaling in the early development of zebrfish swimbladder and xenopus lung
Ngày tải lên :
11/09/2015, 09:07
... different pathways, the canonical Wnt/βcatenin cascade, the planar cell polarity (PCP) pathway, and the Wnt/Ca2+ pathway The latter two are referred to as the non-canonical Wnt pathway since they cannot ... et al, 2005), and has been reported as the earliest lung epithelial marker Nkx2.1 is also functionally important for the separation of trachea and esophagus as well as proper branching and sacculation ... a major part of the digestive tract such as the 16 Chapter I gastrointestinal epithelium as well as certain parts of its evaginated structures such as the liver, pancreas and swimbladder (Stainier,...
- 208
- 287
- 0