development of a stress insensitive mgcuzn nicuzn composite ferrite useful for microinductors ap

Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx

Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx

Ngày tải lên : 30/03/2014, 20:20
... (5¢-TCTCC CGGATCCAAAGAGAAATACCCATA-TA-3¢) to facilitate vector–insert ligation Amplification conditions were at 92 °C, followed by 35 cycles of at 92 °C, 30 s at 55 °C, and and 30 s at 72 °C A final extension ... Institute, San Diego, CA, USA) as a template A BglII restriction site (bold) was introduced into the forward primer (5¢-CCTGTCAGATCTCCGCCAT GGCTAACAATGCATCTCT-3¢), and a BamHI site (bold) was introduced ... CA, USA) as a template PCR was carried out as described above using the forward primer (5¢-AATTCTGCAGTCGACGGT AC-3¢) and the reverse primer (5¢-GATTATGAATTCG AGTCGCGGCCGCTTTACTT-3¢) An EcoRI site...
  • 9
  • 380
  • 0
Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps

Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps

Ngày tải lên : 07/08/2014, 18:21
... emaN ecneuqeS eborP esreveR drawroF eborP esreveR drawroF eborP esreveR drawroF '3-pxGCCAATTTCAGCCCAGGCACAAAm-'5 '3-TYCGGTTYGGGACCATGTT-'5 '3-AACTGTACAGRAGGACGTAGA-'5 '3-TAGCGCATGGTGGGCAACCTCCA-'5 ... 55/lizarb/oriezurc/4 2A rof ecneuqes ehT sniarts 21 eht rof dezylana saw noiger tegrat ehT )ASU ,ratsanD( erawtfos ratsanD eht gnisu dengila dna )1 elbaT( A C aisA 2TAS O O O O O O O O 55/lizarB/oriezurC/4 2A ... '3-TAGCGCATGGTGGGCAACCTCCA-'5 '3-CTGAARATGGGKACCTGCG-'5 '3-GTSCGYTTSTGYCGCACAA-'5 '3-px CCATGGACTTCCCGTAGGAATCGGACAm-'5 '3-CCATTGTRCGCTGTGAGC-'5 '3-CACGACCCCAACGTGTGT-'5 B2 redaeL SERI noigeR seborp dna sremirp cificeps-VDMF...
  • 6
  • 347
  • 0
báo cáo khoa học: "Development of a primary care-based complex care management intervention for chronically ill patients at high risk for hospitalization: a study protocol" potx

báo cáo khoa học: "Development of a primary care-based complex care management intervention for chronically ill patients at high risk for hospitalization: a study protocol" potx

Ngày tải lên : 10/08/2014, 10:23
... internist) and a small number of healthcare assistants (HCAs), who have few clinical tasks HCAs are trained in a three-year part-time curriculum in practice and vocational school Despite some recent approaches ... burden and treatment patterns (analysis of claims data) as well as healthcare needs and resources (patient survey and chart review) This comparison may help us to develop an optimal approach to ... hospitalization (LOH) for all patients from participating practices based on insurance claims data including hospital and ambulatory diagnosis The software package ‘Case Smart Suite Germany’ (CSSG 0.6,...
  • 7
  • 335
  • 0
Development of a flexible forcing immersed boundary lattice boltzmann method and its applications in thermal and particulate flows

Development of a flexible forcing immersed boundary lattice boltzmann method and its applications in thermal and particulate flows

Ngày tải lên : 09/09/2015, 11:16
... approaches are available to model thermal lattice Boltzmann (LB) scheme In the first approach, (also known as multispeed approach) (Chen et al (1994); Watari and Tsutahara 13 Chapter Introduction and ... sources Alternatively, the heat source may have sharp edges with a square/rectangular shape The geometrical difference between a circular and square-shaped heat 18 Chapter Introduction and Literature ... (Alansary et al (2012)), 2) differentially heated walls of an enclosed cavity (De Vahl Davis and Jones (1983); Raji et al (2013)) and 3) a heat source in an enclosure (Deng (2008); Kalyana Raman...
  • 266
  • 644
  • 0
Development of a therapeutic trans sclera illuminated laser delivery device for retinal pathologies

Development of a therapeutic trans sclera illuminated laser delivery device for retinal pathologies

Ngày tải lên : 04/10/2015, 15:52
... laser emission and pivoting axis of a slit lamp laser photocoagulator Rotate Clockwise – Translate downward Rotate Anti-clockwise – Translate upward Translate left Translate backward Translate ... the above system, it is directed towards a non contact, small field of view and a piece meal approach to the delivery of laser to the retina This approach has its limited practical application as ... design APPENDIX 9: Anatomy of the eye APPENDIX 10: Author’s Patent Application vi SUMMARY Laser photocoagulation has been the corner stone of treatment for various retinal pathologies such as diabetic...
  • 129
  • 199
  • 0
Development of a windows based computer aided die design system for die casting

Development of a windows based computer aided die design system for die casting

Ngày tải lên : 04/10/2015, 15:52
... Du Xiaojun, Cao Jian, Saravanakumar Mohanraj, Atiqur Rahman and Low Leng Hwa Maria Financial assistance in the form of research scholarship from the National University of Singapore is also sincerely ... essential for the quick development of a low cost die, as well as to facilitate accuracy in simulation Both Zhang et al [13] and Tai et al [5] developed a CAD/CAE system for die casting The idea was ... modeling to increase standardization 21 CHAPTER DEVELOPMENTAL PLATFORM & TOOL CHAPTER : DEVELOPMENTAL PLATFORM & TOOL This chapter describes the developmental platform and tools used for the prototype...
  • 121
  • 649
  • 0
A preliminary research on development of a fibre composite, curved FDM system

A preliminary research on development of a fibre composite, curved FDM system

Ngày tải lên : 26/09/2015, 09:47
... Proceedings of the International Conference on Manufacturing Automation, Singapore, 2007 Ian Gibson, Savalani Monica Mahesh, Muhammad Tarik Arafat and Liu Yuan, The use of multiple materials in Rapid ... surfaces Applied force F Build Platform a planar layers Supports Former or Mandrel b curved layers Figure 2.2 Comparative layer-based approach for building parts All RP processes are capable of ... are only a few dozens of RP/RM materials commercially available in the market, spread out over all classes of material such as plastics, metals and ceramics Compared to those available to standard...
  • 96
  • 429
  • 0
Development of a micro composite wire MEG sensor

Development of a micro composite wire MEG sensor

Ngày tải lên : 04/10/2015, 15:46
... peak-to-peak voltage, Vpp from channel for different values of Hext A graph of output peak-to-peak Voltage, Vpp (mV) against external The National University of Singapore - Department of Mechanical ... 2500 mA to –2500 mA to obtain varying values of impedance for a specified range of values of Hext The data from the impedance analyzer will finally be used to calculate the magneto-impedance (MI) ... magnetically soft For soft materials, they have high permeability, and are easily magnetized and demagnetized However, for hard materials once they are magnetized, they cannot be demagnetized easily...
  • 144
  • 344
  • 0
Development of a method to measure consumer emotions associated with foods

Development of a method to measure consumer emotions associated with foods

Ngày tải lên : 03/04/2013, 21:07
... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited via internet and/or phone based on ... can get acquainted with the ballot more quickly and shorten the task over each sample evaluation We compared this alphabetized approach with a randomized attribute presentation and found that ... chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy Pizza and chocolate produced the strongest emotions based on Analysis of Variance The terms active, adventurous, affectionate,...
  • 10
  • 781
  • 3
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Ngày tải lên : 28/10/2013, 11:15
... Framework - Introd uced Marine Pests Phase – Consultancy  Identified current management capabilities and approaches  Priorities and hazards for APEC Economies  Considerations for a Risk Management ... Priorities and hazards for Economies  Variable levels of activity and management capability  Ships’ ballast water and hull fouling are the most important vectors  International shipping, aquaculture ... Framework  Conclusions, including the results of the November 2001 Workshop Management Framework - Introd uced Marine Pests Management capabilities and approaches  APEC and the MRCWG have a...
  • 10
  • 583
  • 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Ngày tải lên : 18/02/2014, 17:20
... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were cloned into the EcoRV site of ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...
  • 11
  • 873
  • 0
Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

Ngày tải lên : 05/03/2014, 14:20
... and may contain any number of embedded space characters A command to the SR830 consists of a four characters command mnemonic, arguments if necessary, and a command terminator The SR830 has a 256 ... and resolution and many advantages for studying Raman and Fluorescence spectra We succeeded in obtaining Raman spectra of petrol extracts by 30mW He-Ne laser excitation The high sensitivity of ... overlaps Raman spectrum This was proved very clearly in the Raman spectra of the petrol extract sample 5B110 and 5B11 (petrol extracts from Bach Ho, Vietnam) The Raman spectra excited by He-Ne laser...
  • 6
  • 524
  • 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Ngày tải lên : 07/03/2014, 16:20
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT...
  • 14
  • 473
  • 0
Báo cáo "Development of a software package for 3D structured mesh generation " pdf

Báo cáo "Development of a software package for 3D structured mesh generation " pdf

Ngày tải lên : 14/03/2014, 13:20
... inverse mapping between the 3D real computational domain and a rectangular domain in the parametric space [1, 2, 5, 6] For short, the formulae for Y and Z coordinates are the same and they are not ... simulations 4.1 The graphic user interface of the package The package is designed with a main interface that allows users to input topographical elevation data of the top (upper) surface of any ... generation for the computational domain surrounding a real 3D topography A real 3D topography is considered A 3D computational mesh will be generated for a specific domain surrounding the topography...
  • 14
  • 402
  • 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

Ngày tải lên : 15/03/2014, 00:20
... pretreatment; H + ParA1, ParA1 infiltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 infiltration after ABA treatment All the spectra were representative of at least three ... PR, PA (ParA1 plus adenine), PT (ParA1 plus thiourea), PV (ParA1 plus ascorbic acid) and PC (ParA1 plus catalase) were infiltrated into the same leaves of tobacco plants, which had been sprayed ... 5¢-TGAATTCAATAATGTCTAACTTCCGCGCTCTGTTC-3¢ and 5¢-AGGTACCTCAATGATGATGATGAT GATGATGCAGTGACGCGCACGTAGA-3¢ For the successful protein expression, a yeast expression consensus sequence (including ATG) must...
  • 15
  • 479
  • 0
Development of a simple

Development of a simple

Ngày tải lên : 15/03/2014, 23:56
... Analytica Chimica Acta for the awarded bursary to present a paper at Euroanalysis X (Basel, Switzerland) The authors thank the crew of the R/V Belgica for their assistance during sampling, and Prof ... using a HDPE scrapper Air was expelled and the bag was resealed and then stored at 48C for transport to the laboratory In the laboratory, the particulate material was immediately air dried at 458C ... al / Analytica Chimica Acta 392 (1999) 3±17 Table Procedures used for particle extraction experiments using particulate material from Halton Quay with EDTA, HCl, ammonium acetate and acetic acid...
  • 15
  • 410
  • 0
Báo cáo khoa học: "Development of a Stemming Algorithm" pdf

Báo cáo khoa học: "Development of a Stemming Algorithm" pdf

Ngày tải lên : 16/03/2014, 19:20
... associating related items of information, as they are in an automated library catalogue, and where the catalogue can be interrogated in an on-line mode, it seems best to use a strong algorithm, that ... directorate, but simply part of a verbal root in create and appreciate In English, situations of this type limit the use of suffixes as clues to parts of speech Sometimes grammatical information ... endings, was transmitted to us via personal communication A sample of these suffixes, and further information about the algorithm, have more recently appeared in Salton [9].) A third algorithm has been...
  • 10
  • 360
  • 0
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot

Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot

Ngày tải lên : 23/03/2014, 06:20
... – 2A – 1A QN + 1A + 2A + 3A + 4A + 5A + 6A + 7A + 8A + 9A Fig Assessment of the contribution of each amino acid residue of K5 to substrate recognition Alanine substitution mutants of K5 were produced as ... Institute of Technology, Japan) for providing guinea pig liver TGase 2, Dr T Yoshimura (Graduate School of Bioagricultural Sciences, Nagoya University, Japan) for technical advice on analysis of the ... Yamashita F, Ishida-Yamamoto A, Yamada K, Kinoshita C, Fushiki S, Ueda E, Morishima Y, Tabata K, Yasuno H et al (1998) Defective stratum corneum and early neonatal death in mice lacking the gene for...
  • 11
  • 449
  • 1
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Ngày tải lên : 23/03/2014, 09:20
... Pa1 Pa2 Pa3 Pa4 Pa5 Pa6 Pa7 Pa8 Pa9 Pa10 Pa11 Pa12 Ac-EVYLVE-NH2 Ac-EVYLLE-NH2 Ac-EVYLAE-NH2 Ac-EVYAVE-NH2 Ac-EVYALE-NH2 Ac-EVYAAE-NH2 Ac-ELYLVE-NH2 Ac-ELYAVE-NH2 Ac-ELYLLE-NH2 Ac-ELYLAE-NH2 Ac-ELYALE-NH2 ... metallo-endoprotease of Serratia marcescens (serralysin), are the alkaline proteinase of Pseudomonas aeruginosa, the ZapA metalloprotease of Proteus mirabilis and proetases A, B, C, G and W of ... 1269–1272 Tanaka H, Yamamoto T, Shibuya Y, Nishino N, Tanase S, Miyauchi Y & Kambara T (1992) Activation of human plasma prekallikrein by Pseudomonas aeruginosa elastase II Kinetic analysis and identification...
  • 11
  • 424
  • 0