... the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from ... guidelines approved by the Institutional Animal Care and Use Committee of the University of Tokyo MAPK p-Akt Akt BECs LECs Fig Isolation and characterization of mesenteric BECs and LECs expressing tsA58T...
... a more theoretical analysis of the model Some mathematical properties of the model are discussed, and an easy-to-use method to take into account the evolution of pH and undissociated lactic acid ... accuracy of latter input values is also of major importance Therefore, an adequate calculation method for the actual values of [LaH] and pH at each time point during growth is necessary According ... related to the total amount of lactic acid LaHtot and the pH by the lactic acid chemical equilibrium As explained above, the approach of Nicolaı et al is based ¨ on these chemical principles and...
... Research was conducted in compliance with the Animal Welfare Act and other federal statutes and regulations relating to animals and experiments involving animals and adhered to principles stated ... Care and Use of Laboratory Animals, National Research Council, 1996 The facility where this research was conducted is fully accredited by the Association for Assessment and Accreditation of Laboratory ... (wild-type) and mouse-passaged MARVMusoke, -Ravn, and -Ci67 plaques were counted by standard plaque assay on Vero cells [19] MARV-infected cells and animals were handled under maximum containment in a...
... Research was conducted in compliance with the Animal Welfare Act and other federal statutes and regulations relating to animals and experiments involving animals and adhered to principles stated ... Care and Use of Laboratory Animals, National Research Council, 1996 The facility where this research was conducted is fully accredited by the Association for Assessment and Accreditation of Laboratory ... (wild-type) and mouse-passaged MARVMusoke, -Ravn, and -Ci67 plaques were counted by standard plaque assay on Vero cells [19] MARV-infected cells and animals were handled under maximum containment in a...
... Vaccine and Pediatrics, Pearl River, NY) and David Briles (University of Alabama, Birmingham) and passaged through rats via intraperitoneal challenge as described previously [7] Passaged strains ... Mortality was assessed for days after inoculation Bacteremia was assessed on days and after inoculation The distal dorsal tail vein of each unanesthetized pup was cleansed with 70% alcohol and ... interpretation of the results and in the statistical analysis All authors read and approved the final manuscript Page of (page number not for citation purposes) Journal of Immune Based Therapies and...
... for line art and images whose geometric shapes are simple 1.4 Summary In this chapter the reasons and demands such as saving storage space, transmission time and bandwidth of the image data compression ... more and more human interaction and collaboration 10 Chapter Remote Image Browsing Capability More and more people complain that hospitals or clinics are too far away from the medical imaging examination ... image and enables their interactive discussion and cooperation of the same important portion of the image It also saves the transmission bandwidth and time by transferring only part of the image...
... pre-specified tasks to assist nurses and teachers, and can be employed for animal-assisted therapy (AAT) and animal-assisted activities (AAA) instead of real animals [2] This can partly reduce ... authors evaluated its generalization ability on another two databases: 31 MMI database and JAFFE database The accuracy rates about basic expressions and neutral expression are only 51.1% for MMI and ... universality and continuity of facial expressions in man and animals, and stated the relationships between some inborn emotions and serviceable associated habits Motivated by Darwin’s work, Ekman and...
... Bandopadhyay, Naveen Agarwal, M K Saravanan, Ashok M Prabhu, Desingh Devibalan Balasubramaniam, Dr K Bhupal Redddy, Talasila Sateesh, Li Yuan Ping, Koh Niak Wu, Beatrice and Nandagopal for the nice time ... William, Ganesh Gowrishankar, Brice Rebsamen and Long Bo for their inputs and ideas I was lucky to have a bunch of friends who always kept me cheerful I thank Tirthankar Bandopadhyay, Naveen Agarwal, ... thread and results of equilibrium search (blue) for (b) the Zeeman machine and (c) standard cusp, against analytical equilibria (red), as hand position is varied The chattering due to a very flat...
... chemotherapy, radiation therapy, immunotherapy, monoclonal antibody therapy and gene therapy Each method has its advantages and disadvantages, and depends on the physiology of the individuals as an ... materials selection and the engineering of the nanoparticulate systems that are specifically taken up by targeted cancer cells and subsequently release their drug payload at a plasma concentration ... natural compounds which contain basic nitrogen atoms in the molecular structure Two sub-groups of alkaloids that have the antitumor capability are vinca alkaloids and taxanes The mechanism of...
... home Participants also remarked that the lack of adequate and safe hygiene facilities for women in combat can lead to both physical and mental health issues For example, a lack of adequate facilities ... area, female service members face unique stressors that may impact their mental health Participants noted that serving in the military and/ or as a military contractor is an atypical career path ... critical that military, Department of Veterans Affairs (VA), and private sector providers are prepared to identify and care for the unique needs of female service members, veterans, and contractors...
... classes of phenomena Systematic explanation: Atheory must provide an explanation of the form and significance of the causal and relational mechanisms at work in cases or classes of the phenomena defined ... face validity, and to ask whether the NPM merited formal testing This consisted of two main pieces of work, quantitative data analysis andresearch synthesis Qualitative data analysis We integrated ... et al.: Reorganising the care of depression and other related disorders in the Australian Primary Health Care Setting Canberra: Australian Primary Health Care Research Institute; 2009 May C, Mair...
... classes of phenomena Systematic explanation: Atheory must provide an explanation of the form and significance of the causal and relational mechanisms at work in cases or classes of the phenomena defined ... face validity, and to ask whether the NPM merited formal testing This consisted of two main pieces of work, quantitative data analysis andresearch synthesis Qualitative data analysis We integrated ... et al.: Reorganising the care of depression and other related disorders in the Australian Primary Health Care Setting Canberra: Australian Primary Health Care Research Institute; 2009 May C, Mair...
... Education Standards for educational and psychological testing Washington, DC: American Educational Research Association; 1999 30 American Psychological Association., American Educational Research ... interpretations and applications that are validated To maximize the likelihood of producing valid data in relation to a range of possible interpretations and applications ofa tool, there are development ... relevant versus irrelevant variance); and c) the developmentofa priori, relational hypotheses as a basis for future construct validation ‘The Standards’ contain 24 standards related to validity...
... facial bones and cranial bones as well as intracranial injuries are evaluated based on the tolerance limits of the biomechanical parameters General trend of maximum intracranial biomechanical parameters ... to all of my colleagues and my best friends Arpan Gupta, Guo Shifeng, Zhu Jianhua, Zhuang Han, Liu Yilin, Kyrin Liong, Saeid Arabnejad Khanooki, Shahrokh Sepehri Rahnama, Ahmadali Tahmasebimoradi, ... unpaired vo omer and mandi ible as well as paire lacrimal, nasal, pa ed alatine, infe erior turbin nate, maxillary a zygoma bones The primar function of the cran bones is to and atic ry nial...
... Priorities and hazards for Economies Variable levels of activity and management capability Ships’ ballast water and hull fouling are the most important vectors International shipping, aquaculture ... Framework - Introd uced Marine Pests Phase – Consultancy Identified current management capabilities and approaches Priorities and hazards for APEC Economies Considerations for a Risk Management ... and biodiversity are most threatened values Amount of commercial shipping and number of trading partners affecting pathway strength A limited number of IMP have been identified in APEC Management...
... and editorial tasks The panel also appreciates the assistance of Jon Herrmann and Alan Hais, EPA Office ofResearchandDevelopmentand Hiba Shukairy and Grace Robiou, EPA Office of Water who were ... (3.6 .a) • Databases - Developmentofa list of contaminants and threat scenarios (3.2 .a) - Developmentofa database of important information on the contaminants (3.2.b) - Developmentofa surrogate/simulants ... Action Plan also includes a description of the plan’s implementation Although the Action Plan consists ofa large array of drinking water and wastewater researchand technical support needs and...
... AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT ... (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and sequence of the new ... CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); for Ga15 (5¢-AT GGCCCGGTCCCTGACTTGG-3¢) and (5¢-TCACAGCA...