development of a framework for developmental immunotoxicity dit testing

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Ngày tải lên : 07/03/2014, 16:20
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT...
  • 14
  • 473
  • 0
Báo cáo sinh học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" doc

Báo cáo sinh học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" doc

Ngày tải lên : 18/06/2014, 18:20
... Guide for the Care and Use of Laboratory Animals, National Research Council, 1996 The facility where this research was conducted is fully accredited by the Association for Assessment and Accreditation ... a mouse-adapted variant of Ebola Zaire virus J Comp Pathol 2001, 125(4): Volchkov VE, Chepurnov AA, Volchkova VA, Ternovoj VA, Klenk HD: Molecular characterization of guinea pig-adapted variants ... 'scid-adapted' viruses will allow for more rapid and efficient testing of candidate prophylactic and therapeutic treatments against multiple MARV isolates Initial serial sampling studies to characterize...
  • 13
  • 456
  • 0
Báo cáo hóa học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" docx

Báo cáo hóa học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" docx

Ngày tải lên : 20/06/2014, 01:20
... Guide for the Care and Use of Laboratory Animals, National Research Council, 1996 The facility where this research was conducted is fully accredited by the Association for Assessment and Accreditation ... a mouse-adapted variant of Ebola Zaire virus J Comp Pathol 2001, 125(4): Volchkov VE, Chepurnov AA, Volchkova VA, Ternovoj VA, Klenk HD: Molecular characterization of guinea pig-adapted variants ... 'scid-adapted' viruses will allow for more rapid and efficient testing of candidate prophylactic and therapeutic treatments against multiple MARV isolates Initial serial sampling studies to characterize...
  • 13
  • 431
  • 0
Báo cáo hóa học: "Research Article Development of a Testbed for Wireless Underground Sensor Networks" ppt

Báo cáo hóa học: "Research Article Development of a Testbed for Wireless Underground Sensor Networks" ppt

Ngày tải lên : 21/06/2014, 23:20
... testbed and the realization of WUSN experiments are challenging This work provides a set of guidelines that result in a balanced approach between high accuracy and a practical implementation of a WUSN ... 29 30 the explanation in this section also applies to other types of antenna polarization The original antenna of a Mica2 mote is a standard onequarter wavelength monopole antenna with 17 cm-length ... presented and aspects such as physical layout and software are discussed The use of paper and plastic pipes are considered in detail, explaining the advantages of these devices in the process of burying...
  • 14
  • 248
  • 0
Báo cáo y học: "Development of a method for screening short-lived proteins using green fluorescent protein" pps

Báo cáo y học: "Development of a method for screening short-lived proteins using green fluorescent protein" pps

Ngày tải lên : 14/08/2014, 14:21
... degradation Additional data file contains the original data used to perform this analysis and is available with the online version of this paper interactions Additional data files refereed research ... Ben-Neriah Y, Baeuuerle PA: Rapid proteolysis of I kappa B-alpha is necessary for activation of transcription factor NF-kappa B Nature 1993, 365:182-185 Beg AA, Finco TS, Nantermet PV, Baldwin AS Jr: ... cultured and used for plasmid preparation We transfected these 12 groups of plasmid DNA into 293T cells and again subjected them to FACS analysis and gating as before The EGFP-C1 vector was used as a...
  • 8
  • 291
  • 0
Design and development of a bioreactor for ligament tissue engineering

Design and development of a bioreactor for ligament tissue engineering

Ngày tải lên : 04/10/2015, 10:25
... (lateral collateral ligament and medial collateral ligament), and two interior ligaments (anterior cruciate ligament (ACL) and posterior cruciate ligament), which help control stabilisation and ... torsional strain alone acts to translate individual fibers organised in a helical geometry, translational strains are needed to control fiber pitch angle and mimic anterior draw loads typically stabilised ... be a promising alternative in using cell transplantation as a strategy to achieve tissue repair and regeneration for a variety of therapeutic needs One approach involves use of three-dimensional...
  • 141
  • 239
  • 0
Development of a bioreactor for in vitro engineering of soft tissues

Development of a bioreactor for in vitro engineering of soft tissues

Ngày tải lên : 04/10/2015, 15:46
... and Structural Stiffness for each groups (mean ± SD) 101 Table G-1 Alamar Blue reading and % reduction calculation for Day 132 Table G – Alamar Blue reading and % reduction calculation for Day ... After that, all bioreactors parts are assembled inside a biological safety cabinet The basic straining mechanism of bioreactors for tubular form scaffolds and sheet form scaffolds are the same One ... each orientation angle for all sample groups 39 Table 4.1 Physical properties of various suitable plastics; (· · mean steam Autoclavable, X mean not autoclavable) [extracted from www.nuncbrand.com]...
  • 151
  • 253
  • 0
Exploration of a framework for behavior based malware detection and classification

Exploration of a framework for behavior based malware detection and classification

Ngày tải lên : 05/10/2015, 22:15
... that malware behaviors are composed of basic behavior blocks that are shared mainly between malware variants of the same family, and among a small number of malwares in other families This means ... Behavioral Approach Our behavior-based approach utilizes high-level behaviors for malware detection The basic assumptions that we made are that all malware have shared behaviors, and must perform ... is also another vector These are all attack vectors that most research cannot guard against Our behavioral approach concentrates on dynamically looking for behaviors that indicate malwares had...
  • 159
  • 401
  • 0
DEVELOPMENT OF a BLUEPRINT FOR COMPUTER BASED TRAINING (CBT) IN THE USE OF ELECTRONIC CHART DISPLAY AND INFORMATION SYSTEMS (ECDIS)

DEVELOPMENT OF a BLUEPRINT FOR COMPUTER BASED TRAINING (CBT) IN THE USE OF ELECTRONIC CHART DISPLAY AND INFORMATION SYSTEMS (ECDIS)

Ngày tải lên : 09/05/2016, 16:54
... of and ability to use navigational charts and publications, …” Criteria for evaluating competency are stated as “The charts selected are the largest scale suitable for the area of navigation and ... ensure appropriate selection EXPLAIN ALL SAFETY-RELEVANT AS WELL AS OTHER MAJOR CHARACTERISTICS OF ECDIS DATA SUCH AS DATA CONTENTS, HANDLE ECDIS DATA ON BOARD AND ASSESS ALL ERRORS, INACCURACIES AND ... presentation of other navigational information, such as radar and AIS QUESTION A IMO REF SUBJECT MATTER WHAT ADDITIONAL INFORMATION IS NEEDED ? a What other information can this system display ?...
  • 62
  • 405
  • 1
the ethical hack - a framework for business value penetration testing

the ethical hack - a framework for business value penetration testing

Ngày tải lên : 25/03/2014, 12:12
... goal is to not abandon these disadvantages and attempt to fully imitate a hacker Simply approach an ethical hack—as a customer or consultant—fully aware of your disadvantages and limitations, and ... technical exploitation Having a tester penetrate an online application and gain access to a database of credit card numbers has significant tangible characteristics, which are therefore easy to measure ... derivative of a military term and I have heard it used in Taiwan and Japan, another place the use of ethical hacking, as the name of an act, does not go over well Nevertheless, the most predominant...
  • 331
  • 790
  • 0
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Ngày tải lên : 28/10/2013, 11:15
... Priorities and hazards for Economies  Variable levels of activity and management capability  Ships’ ballast water and hull fouling are the most important vectors  International shipping, aquaculture ... Framework - Introd uced Marine Pests Phase – Consultancy  Identified current management capabilities and approaches  Priorities and hazards for APEC Economies  Considerations for a Risk Management ... and biodiversity are most threatened values  Amount of commercial shipping and number of trading partners affecting pathway strength  A limited number of IMP have been identified in APEC Management...
  • 10
  • 583
  • 0
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_1 pptx

Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_1 pptx

Ngày tải lên : 20/06/2014, 18:20
... timely and well worth reading, given the many changes afoot in the areas of exchange regulation and clearing.’ HARVEY L PITT Chief Executive Of cer of Kalorama Partners and former Chairman of the ... Directive Minneapolis Grain Exchange million Multilateral Trading Facility not applicable National Association of Securities Dealers National Association of Securities Dealers Automated Quotation System ... types and categories Transaction costs in the Value Provision Network Categorisation of direct transaction costs Categorisation of clearing-related cost of capital Categorisation of clearing-related...
  • 38
  • 542
  • 0
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_2 pptx

Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_2 pptx

Ngày tải lên : 20/06/2014, 18:20
... providing a definition of clearing 2.2 Value-Added of CCP Clearing Outlines value-added of clearing for individual market participants, for capital markets as a whole and according to asset classes ... novation, netting and risk management, as well as transaction/position management, collateral management and cash management The scope of netting and risk management services that a CCP can offer ... relevant for risk management, as well as services valuable to users Cash management comprises operational and treasury management Operational cash management includes the processing of cash instructions...
  • 38
  • 584
  • 0
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_4 potx

Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_4 potx

Ngày tải lên : 20/06/2014, 18:20
... prevent failures The error rate climbs dramatically in the absence of STP A lack of STP can lead to a high degree of manual intervention being required At its most sophisticated form, automation allows ... worse off in terms of financial resources available in a default situation than for internal offsets This means that in case the defaulting clearing member’s account is in profit at one clearing ... consist of a default fund, a margining regime that collateralises the obligations of both the clearing members and their customers and the imposition of minimum financial and capital adequacy requirements...
  • 38
  • 469
  • 0
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_5 potx

Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_5 potx

Ngày tải lên : 20/06/2014, 18:20
... general relevance of CCP clearing; Part asked for concrete cost data and concerned the transaction cost analysis of derivatives clearing; Part contained closed questions related to analysing demand- ... that are collateral rich and those that are collateral poor.34 The collateral poor tend to be the large trading houses, such as arcades,35 with a high proportion of day trading and low capital ... enough capital available; r clearing houses can serve as a cheap form of custody; and r clearing houses pay interest on most collateral The collateral-rich clearing members usually have large bond...
  • 38
  • 617
  • 0
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_6 doc

Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_6 doc

Ngày tải lên : 20/06/2014, 18:20
... programming interfaces (APIs), standard formatted language, 111 Cf Berliand (2006), p 27 183 Analysing costs of derivatives clearing – transaction cost studies collateral management capabilities, ... replacing manual processes with machines, particularly for repetitive and redundant tasks Internal measures are critical for clearers, because such initiatives can potentially reap significant savings ... consolidation and leveraging of systems, functions and knowledge, but are mainly suitable for high volume clearers active in several markets and geographical locations Additionally, the internal standardisation...
  • 38
  • 418
  • 0
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_7 pdf

Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_7 pdf

Ngày tải lên : 20/06/2014, 18:20
... opportunities and a higher number of transactions available for cross-margining Clearing members benefit from collateral management optimisation through savings in cost of capital and back -of ce costs Additionally, ... balance sheet variables such as revenue or profit) is not adequate for this analysis, as these indicators generate a biased picture for a number of reasons; the use of P&L-related variables can ... terms of the ‘advantages of specialisation’ obtained through the division of labour.102 In addition, economies of scale can be elucidated mathematically.103 Learning effects can also generate scale...
  • 38
  • 515
  • 0
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_9 docx

Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_9 docx

Ngày tải lên : 20/06/2014, 18:20
... particular can thus benefit from direct access to the away market: Many of the Asian brokerage firms tend to be smaller; they don’t have the capital of a Morgan Stanley or a Goldman Sachs, so the Asian ... clearing houses (the OCC, the CME and ECAG) and has maintained its status as Europe’s largest exchange-traded derivatives CCP.45 Market participants can apply for admission as either a General ... some of my competitors get very worried.22 I am slightly conflicted in that part of what we have as a competitive advantage is that we can actually offer all these exchange accesses anyway People...
  • 38
  • 406
  • 0
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_10 pdf

Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_10 pdf

Ngày tải lên : 20/06/2014, 18:20
... required ECAG to deal with a greater number of technical, operational and legal adaptations than CCorp Although Phase II has not been implemented to date, both clearing houses had already started ... any market other than that of Eurex thus requires the deployment of a European clearing intermediary.121 All it is is a cheaper way of offering GCM services, at the end of the day And the reason ... Efficiency Gains LOW HIGH Profit Decrease CMAG Theoretical Assessment of Clearing Links as in Chapter CMPG Theoretical Assessment of Clearing Links as in Chapter CMAR GCL Assessment for ECAG and CCorp...
  • 38
  • 629
  • 0
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_12 pdf

Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_12 pdf

Ngày tải lên : 20/06/2014, 18:20
... usually not have the leeway to benefit from and further leverage their installed base r Single CCP initiatives (as a particular form of M &A initiatives) have the drawback that the majority of ... clearing and settlement infrastructure The basic conditions for this goal are transparency and open access To avoid discrimination against classes of participants and competitive distortions, participation ... using a network in every conceivable way, but if managers look at usage in the aggregate, they will see patterns emerge And that’s important because for each major usage pattern that managers...
  • 38
  • 395
  • 0