development enhancement of the ability to use the higher order analytic and critical thinking skills needed to understand and c

50 shades of the common core for ELA critical thinking for all 1

Ngày tải lên : 06/05/2016, 23:49

... Reading comprehension… “close, attentive reading”… critical reading”… “reasoning and use of evidence”… “comprehend, evaluate, synthesize”… understand precisely…question…assess the veracity” … “cite ... Receptive Vocabulary (in) & Expressive Vocabulary (out) Now What? Directions: For each word, write a sentence and use the word correctly in the sentence 1.epiphenomenal: having the character of or ... practice with complex text and its academic vocabulary The Anchor Standards for Reading Literary Fiction & Informational Non-Fiction Text-based understanding & comprehension Central message/theme/BIG...

80
203
0

Business development strategies of the National Southern Oil Spill Response Center (NASOS) period 2013-2017 and the vision to 2020

Ngày tải lên : 27/03/2015, 15:15

153
285
0

General development strategy of Vietnam Cement Industry Corporation (VICEM) in 2009-2020 and the direction to 2050

Ngày tải lên : 27/03/2015, 15:42

104
277
0

Báo cáo y học: "Enhancement of the Click Chemistry for the Inverse Diels Alder Technology by Functionalization of Amide-Based Monomers"

Ngày tải lên : 25/10/2012, 11:00

... completion, the second ligation reaction with the pentenoic acid begins The process of the chemical reaction can be monitored by the colour change and the end of the reaction is indicated by decolorization ... modern therapeutic drugs and diagnostic molecules Chemical Procedures Pentenoic acid chloride and cyclopentene carboxylic acid chloride were purchased from Sigma Aldrich, Germany The synthesis of the ... CO2Me CO2Me CO2Me N O C CO2Me N N HN HN HN MeO 2C MeO 2C OC N H N O C OC N H MeO 2C OC OC N O C N H N O C N N H CONH2 13 Figure describes the reaction product of 13 after chemical ligation by the...

10
756
0

Comparing the cultural and linguistic analysis of the English word “meal” and words relating to it in contrast with Vietnamese equivalents.

Ngày tải lên : 15/04/2013, 15:11

... consists of a packet of crips, a piece of fruit and a drink and with which they also have a cup of tea or coffee, probably made in the office The packed lunch is kept in a plastic container This ... middle of the table Family eating etiquette is not too much difficult The oldest or the husband of the family sits at the head of the table and others sit in descending order according to age ... people used two sticks to pick up food It is the primitive image of chopsticks Over the time, chopsticks have been changed and it becomes chopsticks now Besides, there is a legend behind the conception...

54
1K
1

The Role of the Media in Promoting and Reducing Tobacco Use doc

Ngày tải lên : 06/03/2014, 01:20

... understand and to decrease the disease burden caused by tobacco use Cigarettes are a product of the mass media era; the art and science of mass communications and mass marketing were critical to the ... journalistic practices and tobacco industry efforts to influence news coverage), the nature of the media environment (how news on tobacco use and its effects are covered or the depiction of tobacco use ... tobacco industry have used news and entertainment media to advocate their positions and how such coverage relates to tobacco use and tobacco policy change The section also appraises evidence of the...

684
1.4K
0

Future Development of the Higher Education Economic Development (HEED) Fund doc

Ngày tải lên : 08/03/2014, 09:20

... INTRODUCTION This Circular sets out for consultation the core principles of the Council’s Higher Education Economic Development (HEED) Fund, together with the proposed funding formula to be used to ... Corporate Plan, the Council can measure HEIs’ contribution to economic, cultural and social benefit in a way that monitors the proper use of public funds and/ or incentivises and optimises such ... support of teaching and research To enable the sector to proceed along common lines, it is necessary to be clear on how we perceive and define third mission activities and their future development and...

10
281
1

Joint Guidance on the Application of the Family Educational Rights and Privacy Act (FERPA) And the Health Insurance Portability and Accountability Act of 1996 (HIPAA) To Student Health Records docx

Ngày tải lên : 22/03/2014, 15:21

... respect to the education records of the student placed at the private school An educational agency or institution subject to FERPA may not have a policy or practice of disclosing the education records ... services directly to students and are not employed by, under contract to, or otherwise acting on behalf of the school In these circumstances, these records are not “education records” subject to ... disclosure of the mental health records of a student maintained as treatment records at the campus clinic, the university may disclose the records to comply with the court order in accordance...

13
464
0

Báo cáo hóa học: " Development and validation of a Greek language version of the Manchester Foot Pain and Disability Index" docx

Ngày tải lên : 18/06/2014, 22:20

... (item 17) The final Greek version is shown in Figure Characteristics of sample The characteristics of the sample, including sex, prevalence of major medical conditions and medication use is shown ... had any of the 15 common conditions listed Participants who reported foot pain were asked to indicate the location of the pain on eight diagrams of the feet The participants then completed the Greek ... relating to the participants' age, medical history and foot pain location was interviewer administered The medical history section of the questionnaire required the participant to state whether they...

9
481
0

báo cáo hóa học:" Mapping of the Insomnia Severity Index and Other Sleep Measures to EuroQol EQ-5D Health State Utilities" ppt

Ngày tải lên : 20/06/2014, 15:20

... neuropathic pain, respiratory condition, and schizophrenia The decision to use a single binary(yes/no) comorbidity presence indicator rather than one variable per condition or counting the sum of the total ... sufficient number of predictions to account for variability Average values from the 30 validations were calculated for each of the models To determine the predictive precision of the models, we computed ... during the night Predictors in Model IV were supplemented with patient characteristics such as age, gender, and the presence/absence of comorbidities The comorbidity predictor was constructed as...

37
344
1

Báo cáo toán học: " Enhancement of the photoelectric performance of dye-sensitized solar cells by using Ag-doped TiO2 nanofiber in TiO2 nanoparticle film as an electrode" pot

Ngày tải lên : 20/06/2014, 20:20

... voltage of 20 kV, a flow rate of 50 µL/min, and a tip to collector distance of 15 cm The prepared electrospun fiber was calcinated at 500 C Preparation of the TiO2 photoelectrode and the Pt electrode ... electron lifetime and the reduction of the electron transit time can explain the increment of Jsc by the addition of ATN Conclusions In conclusion, TN and ATN were added into the TiO2 film of ... into electrons, and the DSSCs with ATN stop the recombination of the electronic process The conversion efficiency of TiO2 photoelectrode-based DSSCs was 4.74%; it was increased to 6.13% after...

16
396
0

Collaboration for Agriculture & Rural Development: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS3 " ppt

Ngày tải lên : 21/06/2014, 06:20

... questionnaire The survey concentrated on the effect of current cashew husbandry practices on the environment, assessment of cashew production, use of labour, pest and disease practices and assessment of ... questionnaire The survey concentrated on six aspects in relation to • Current cashew husbandry practices, including the use of chemical pesticides and fertilizers, • Assessment of cashew production, ... for the development of the cashew IPM curriculum for the period of cashew monsoon flush A total of 175 photos of the main insect pests, diseases, natural enemies and cashew orchard management skills...

10
327
1

báo cáo hóa học:" Research Article Pitch- and Formant-Based Order Adaptation of the Fractional Fourier Transform and Its Application to Speech Recognition" pptx

Ngày tải lên : 21/06/2014, 20:20

... peaks) of voiced speech These order selection methods are speciﬁcally proposed according to the characteristics of speech, and their merits are indicated by FFT and FrFT based spectrograms of an ... noise in the other channel Each of the test sets contains 16 instances of each of the 24 consonants, giving a total of 2688 tokens in the combined test set Consonant Challenge Speech Recognition ... pitch is detected The formants are determined as the frequencies of the LPC-based spectral peaks The order of the LPC analysis is set to be twice the number of formants (or twice the number of...

14
384
0

Biomonitoring of the lower Mekong River and selected tributaries, 2004 to 2007 pps

Ngày tải lên : 06/07/2014, 22:20

... vegetation, and the disappearance of certain types of animals These sorts of changes cannot be predicted accurately from physical and chemical monitoring because of the complexity of ecological relationships ... single celled or multi-cellular They are often secondary producers that live off phytoplankton (including diatoms) or other zooplankton Zooplankton can be useful biological indicators of the ecological ... in their completeness and accuracy Perhaps the best studied organism that occurs in the river is the snail Neotricula aperta, which is the intermediate host of Schistosoma mekongi, the vector of...

100
869
1

Báo cáo y học: " Antigenic analysis of classical swine fever virus E2 glycoprotein using pig antibodies identifies residues contributing to antigenic variation of the vaccine C-strain and group 2 strains circulating in China" ppt

Ngày tải lên : 11/08/2014, 21:21

... amplified Location in the C- strain genomed BC unit C- E2-BC-r 5-AAACTCGAGTCAGAAAGCACTACCG BC unit C- E2-AD-f C- E2-AD-r 5-AAGGATCCATGCGGCTAGCCTGCAAG 5-TAGCTCGAGTCAATCTTCATTTTCCAC BC + AD units BC + AD ... 5-TAGCTCGAGTCAATCTTCATTTTCCAC BC + AD units BC + AD units C- E2-f 5-TTTGGATCCGCCACCATGGTATTAA GGGGA CAGATCG 5-ATTCTCGAGTCAACCAGCGGCGA GTTGTTCTG 2442-2465 C- E2-r 2804-2816 Vaccine C- strain 2442-2456 2955-2969 Full-size ... Primers used in PCR amplification of various recombinant E2 proteins Nucleotide sequenceb Primer designationa C- E2-BC-f Target region of E2 proteinc 5-AAAGGATCCATGCGCTTAGCCTGCAAG GAAGATTAC CFSV...

14
626
0

Báo cáo sinh học: "An automated stochastic approach to the identification of the protein specificity determinants and functional subfamilies" pot

Ngày tải lên : 12/08/2014, 17:20

... analyzing contact in structures of LacI and PDE family members, we always assume 5Å to be the cutoff for two atoms to be contacting each other, and contacting residues are defined by the contact of their ... sequences responding to the effector molecule We considered a subset of proteins, differing in their specificity to the effector and the operator sequence, that included ten ortholog rows CcpA, CytR, ... procedure Then we consider each sequence of the MSA as a sequence of unknown specificity, and use SDPprofile to reassign it to one of the specificity groups After this step, most of sequences would...

12
445
0

Báo cáo sinh học: " Enhancement of the expression of HCV core gene does not enhance core-specific immune response in DNA immunization: advantages of the heterologous DNA prime, protein boost immunization regimen" ppsx

Ngày tải lên : 14/08/2014, 19:22

... another set of primers that carried Kozak consensus sequence sense AGCTGCTAGCGCCGCCACCATGAGCACGAATCCT and antisense GATCGTTAACTAAGCGGAAGCTGGATGG primers containing recognition sites of restriction ... detection of HCV core proteins Immunocytochemical detection of HCV core proteins Immunocytochemical detection of HCV core expression after transfection of BHK-21 cellswith pCMVcore (A1 C1 ), pCMVcoreKozak ... sense-GACCCAAGCTTCGTAGACCGTGCACCAT and antisense CATGCTCGAGTTAGGCGTATGCTCG primers The amplified DNA was cleaved with HindIII/XhoI and inserted into pcDNA3 cleaved with HindIII/XhoI resulting in pCMVcoreIRES...

17
271
0

Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 1 ppsx

Ngày tải lên : 14/08/2014, 22:21

... extensive use of producer subsidies in the OECD countries and the fact that the OECD constitutes two-thirds of world agricultural trade underscore the centrality of their policies to development outcomes ... D .C. : World Bank Abbreviations and Data Notes ACE Automated commercial environment ACP African Caribbean and Pacific states ACPC Association of Coffee Producing Countries AGOA African Growth and ... on their own tariffs, they succeed in obtaining commitments to greater market access in products and services of importance to them, a new commitment to consistency in the administration of preferences,...

34
222
0

Global Economic Prospects Realizing the Development Promise of the Doha Agenda phần 2 pps

Ngày tải lên : 14/08/2014, 22:21

... military action began Economic and noneconomic determinants of confidence The impact of noneconomic factors such as ‘terrorist threats’ and ‘war jitters’ on consumer confidence and spending can be ... question of some concern (box 1.2) The present level of the current account deficit, at 5.1 percent of GDP in the first quarter of 2003, is an historic record Of particular concern is the unprecedented ... quick resolution in Iraq The decomposition of consumer confidence into economic and non-economic components is not straightforward By definition, the economic component should track coincident and...

33
258
0