... discussion); and, a ‘Discussion Area’ For each activity, a single graphic was selected and placed at the top left corner of each page of that activity as a visual cue for students engaged in a particular ... experienced while navigating through the siteA suggested enhancement to the navigational capability of the site was a text-based replication ofsite navigation bar at the top of each page to make scrolling ... appropriateness of graphics and icons, clarity and quality of information, suitability of external links, and clarity and perceived motivating and discussion promoting characteristics of the learning activities...
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... 5¢-CTAGACTCGAGCCTAAT TTATATTTGCTCCTTGTGC-3¢ b-Actin primers were designed as follows: forward 5¢-CTACAATGAGCTGCG TGT-3¢ and reverse 5¢-AAGGAAGGCTGGAAGAGT-3¢ Cell survival and apoptosis analysis In vivo interaction ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and...
... two specific primers For 6I 5¢-CGATGAATTC GTTAACGCTCATCACCATCACCATCACGGGAAA TTGGCCATGGGGT-3¢ containing a HpaI siteand Back 6I 5¢-CGATGGTACCGTACTTGTTCATGCTTAGG-3¢ and subcloned into pUC19 for further ... gland, caudate nucleus, temporal lobe, hippocampus, and fetal tissues (brain, kidney, thymus, liver), and rather weakly in placenta, lung, aorta, amygdala, occipital and parietal lobe and salivary ... glycoprotein a1 -Acid glycoprotein Fetuin Galb1-4GlcNAc-Ra NeuAca2-6Galb1-4GlcNAc-R NeuAca2-3Galb1-3GalNAca1-O-Ser/Thrc NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thrc NeuAca2-6(3)Galb1-4GlcNAc-Rc Galb1-3GalNAca1-O-Ser/Thr...
... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKA VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSL AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV Mrcp19k Bacp19k Bicp19k 130 140 ... gold and alkylated gold, and from a quantitative amino acid analysis for glass and the formaldehyde resin (see details in supplementary Fig S3) Surface area per molecule was calculated by a assuming ... chemicals used were of the highest grade available, with most being purchased from Wako Pure Chemical Industries (Osaka, Japan) and Takara Shuzo Co (Otsu, Japan) Twofold-concentrated ASW was prepared...
... band corresponded to the gradual increase in intensity ofa higher-molecular-mass band The apparent molecular mass of this band was 38 kDa, which is substantially higher than the molecular mass ... grade Purification of smelt AFP Blood plasma was obtained from a population of rainbow smelt (O mordax) caught in seawater along the northeastern coast of Newfoundland on 20 February 1997 and stored ... function as an AFP as well as its relationship to other CTLDs MATERIALS AND METHODS Materials N-Glycosidase F and endoproteinase Glu-C were obtained from Roche Molecular Biochemicals (Laval, Canada)...
... characterized by minima at 207 nm and by a maximum at 190 nm The negative band at 207 nm had a lower intensity in the case of rBmKIM in comparison with that in the spectra of AaHIT2 (a- toxin) and ... primers A3 were as follows: 5¢-GCCGGATCCCCGATGACGATGACAAG GATGGATATATAAGA-3¢ as forward primer containing a BamHI restriction enzyme site (underlined) and corresponding to five codons encoding an enterokinase ... following: forward primer A1 , 5¢-GCCGGATCCTGATTGCCTA GAAGATGA-3¢; reverse primer A2 , 5¢-GCCCTCGAG TCAACCGCATGTATTACTTTCAG-3¢ The forward and reverse primers were preceded by BamHI and XhoI sites (underlined),...
... every packet being encapsulated and decapsulated both at MR and HA (3) Bottlenecks in HA is an important problem, since a significant amount of traffic for MNNs is aggregated at HA, particularly when ... regarding NEMO and MANET, are also introduced, such as Multihoming, Route Optimization, and MANEMO 2.1 VANET Vehicular Ad hoc Networks (VANET) are a particular case of MANET, but they are characterized ... reports the amount of transferred data and used bandwidth Additionally, the GPS patch appends location information (latitude and longitude) as well as the offset and distance from the starting point...
... growing phases - that is, lag, early, mid, and late exponential and early and late stationary phases With these data, investigators should be able to obtain a dynamic picture of protein occupancy ... supercoiling - a global transcriptional regulator for enterobacterial growth? Nat Rev Microbiol 2005, 3:157-169 Ali Azam T, Iwata A, Nishimura A, Ueda S, Ishihama A: Growth phase-dependent variation in ... Escherichia coli genome and identifies unconventional target sites Genes Dev 2005, 19:2619-2630 20 Gama-Castro S, Jiménez-Jacinto V, Peralta-Gil M, SantosZavaleta A, Peñaloza-Spinola MI, Contreras-Moreira...
... 5'-CCCGACGATCAGGATA-3' 5'-ACCGCCGGGATGAGTT-3' 5'-CCGCCTCCACGAACAA-3' 5'-TTCCGTTTCGTTTCTTCAA-3' 5'-TGGCCATAACCATTTTAGATAT-3' 5'-GGGTTTCATATGAAGATCGAGGTGAGAGAA-3' 5'-CGGGATCCTTAGATATCATATAGGAACTTGC-3' ... N-hydroxycinnamoyl/benzoyltransferase from I batatas (AB035183); AtHCT, shikimate/quinate hydroxycinnamoyltransferase ofA thaliana (At5g48930); NtHCT, shikimate/ quinate hydroxycinnamoyltransferase of N tabacum (AJ507825); ... hydroxycinnamoyl CoA quinate transferase of N tabacum (CAE46932); LeHQT, hydroxycinnamoyl CoA quinate transferase of L esculentum (CAE46933); At2G19070 and At5G57840, A thaliana genes encoding putative...
... particular, I would like to thank Albertus Hendrawan, Huang Weiwei, Tan Boon Hwa, Syeda Mariam Ahmed, Mohan Gunasekaran, Peng Chang, Chen Nutan, Feng Xiaobing, Chao Shuzhe, Chanaka Dilhan Senanayake, ... motion of the device should be at least equal to the human range of motion during gait rehabilitation and activities of daily living (ADL) These data can be found by examining of clinical gait analysis ... 2.3 Summary In this chapter, we gave an overview of lower extremity exoskeleton research in a range of applications The advantages and disadvantages of several types of control methods are also...
... Characterization of flavonoids on PPARα and PPARγ activity 103 3.3 Characterization of flavonoids and PPARα ligands on a natural PPARα V22 7A variant 124 3.4 Mechanism(s) elucidation of attenuated ... 2004 at Shanghai International Convention Center, Shanghai, China xiv ABBREVIATIONS 15dPGJ2 Å3 ABCA1 ACO Acrp30 AD AF-1 AF-2 AM aP2 apoA-I apoA-II apoA-V apoC-III AR bp Bio Cal CAP350 CARM-1 ... clinical data on the use of PPARγ agonists for the treatment of diabetes and the use of PPARα agonists for the treatment of dyslipidemia and coronary heart disease makes it likely that dual PPARα and...
... mammals (Bandyopadhyay et al., 1999; Bandyopadhyay et al., 2002) It contains a signal peptide at the N-terminus, a ZP domain, a C-terminal putative TMD, anda cytoplasmic tail (Lopez-Casillas ... Molecular Cloning and Characterization ofa Putative Oncogene, HuUO-44, in Human Ovarian Carcinogenesis Awarded AVON international scholar-in-training award poster presented at the 94th American Association ... Northern, Cancer Profiling Array and Cancer Cell Line Profiling Array 3.9 Semi-quantitative RT-PCR of Human and Rat UO-44 3.10 Quantitative (Real-time) PCR of UO-44 3.11 Generation and Transfection...
... from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT TTCCTGTTCCAGCCACAAAAAT), with the altered ... bold and underlined The F13 3A mutation was created using the following primers: F133Afw (5¢-GTGGCTGGAACAGGAGCGCCATATTTTACA ACTGATTCG) and F13 3A- rv (5¢-CGAATCAGTTGTAA AATATGGCGCTCCTGTTCCAGCCAC) ... the lack of GTP activation [8] A comparison of UMPKs from U parvum, E coli and S solfataricus, chosen to represent mycoplasma, bacteria and archaea, showed that they all shared the same fold As...
... second set, A5 2 (5¢AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8 (5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); third set, A5 3 (5¢-CGAGAGGAGCATTAGA-TAGATG Ó FEBS 2002 CAG-3¢)/TRHR-9 (5¢-GCCGAAATGTTGATGCCCA GATAC-3¢) (Fig ... CGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TC TGTTAAATGTACCTAAGTAGGCA-3¢) and TRHR2-2 sense (5¢-CAGCAAAATGGAAAATAGTAGC-3¢)/ TRHR2-4 antisense (5¢-CGACACTGTAGTAG-AGAT CACC-3¢), respectively The PCR ... ventral and dorsal skin, testis, stomach, intestine, urinary bladder and lungs of adult male Xenopus laevis toads Poly (A) + RNA extracted from rat testes and ovaries were used as positive and negative...
... FITC was measured in the FL1 channel (510–535 nm bandpass filter) Data were recorded and analyzed with flowmax software from Partec Statistical analysis of ELISA experiments Each experiment was repeated ... produces a variety of cell surface-associated and extracellular factors that enable bacteria to colonize and multiply within the host to evade host defences and to destroy host tissues [11] Attachment ... Injection began at s and ended at 180 s Table Affinity parameters for NTD–FnBR interactions The parameters were determined by SPR measurements, with immobilized FnBRs of FnBPA and FnBPB as ligands and...
... (blastula, gastrula, trochophore larvae, D larvae, and 14 days post fertilization larvae, pediveliger larvae and metamorphosing larvae) were used as samples Although Cg-BMPR1 and Cg-TGFbsfR2 transcripts ... BMP/activin pathway in Crassostrea gigas A Herpin et al A Crassostrea gigas C2 domain ALK-6 E fluviatilis C2 domain 77 Crassostrea gigas C1 domain 76 88 Wit D melanogaster ActR-2b H sapiens 92 Activin ... method of the PAUP package The percentage recovery of the branch in 1000 bootstrap replications is indicated ActR2b Carassius auratus (ABB58749)Daf-1 Caenohabditis elegans (P20792), Daf-4 Caenohabditis...
... peptide was recorded by sensorgrams allowing an association time of 300 s anda dissociation of 180 s under a constant flow rate of 20 lLÆmin)1 at 25 °C The sensorgram profile of each run was subtracted ... coating, the HNE peptide was at least partially oxidized and the signal of the reduced species increased as a result of oxidation Identification of the active isoform Because of disulfide scrambling ... bonds stabilizes a conformational epitope of the apical membrane antigen-1 of Plasmodium falciparum [27] Although the sequential epitope of VP1 of foot and mouth disease does not contain intramolecular...
... trifluoroacetic acid and d-ACTX-Hv 1a and d-ACTX-Ar1 isolated and purified by RP-HPLC Purification was achieved using a Pharmacia HPLC system using a Vydac analytical rpHPLC column ˚ (C18, 250 · 4.6 mm, 300 A, ... Notably, at nanomolar concentrations d-ACTX-Ar1 and -Hv 1a completely inhibit the binding of classical scorpion a- toxins (e.g Aah-II and Lqh-II) to rat brain synaptosomes as well as the binding of ... trifluoroacetic acid over 20 at a flow rate of 1Æml min)1 Toxin quantification was performed using a bicinchoninic acid Protein Assay Kit (Pierce) using BSA as a standard Absorbance was read at 570...
... Cloning and characterization of Na+ channel b1B (Eur J Biochem 270) 4763 reaction (RT-PCR) and RACE-PCR Marathon-ReadyTM human adrenal gland and fetal brain cDNA libraries were purchased from ... probe was labeled and purified as described above A kb human b-actin cDNA fragment was used as the control probe and labeled with Ready-To-GoTM DNA Labelling Bead (–dCTP) (Amersham Pharmacia Biotech.), ... used for acquisition and analysis of data Leakage and linear capacity currents were subtracted by using P/4 protocols Data were sampled once every ls and were filtered at 1/5 of the sampling frequency...
... Geneva, Switzerland Venkatraman Chandra-Mouli World Health Organization (WHO)/Headquarters, Geneva, Switzerland Ingrid Cox World Health Organization (WHO)/Headquarters, Geneva, Switzerland Amaya ... scope and amount of services that can be provided, the availability of trained staff, and the capacity to plan and evaluate efforts Knowing this information allows the team to draw on available ... Vietnam Only 10% of female and 20% of male secondary school students in urban areas of Nairobi, Kenya, and 12% of females and males under the age of 20 from Chile practice contraception regularly...