describe the development of cancer as a multistep process
Tài liệu The Man of Letters as a Man of Business docx
Ngày tải lên :
17/02/2014, 19:20
... that there is always a danger
that the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and that
if the magazine is not to pass away with the ... is the case of authorship as it now stands with regard to the magazines. I am not sure that the case
is in every way improved for young authors. The magazines all maintain a staff for the careful ... their
emotions raw, or at least saignantes from the joint of fact, and not prepared by the fancy or the taste.
The syndicate has no doubt advanced the prosperity of the short story by increasing the demand...
- 21
- 544
- 0
Tài liệu RESULTS BASED MANAGEMENT IN THE DEVELOPMENT CO-OPERATION AGENCIES: A REVIEW OF EXPERIENCE docx
Ngày tải lên :
21/02/2014, 11:20
... agency, as well as the donor country’s parliament and taxpayers.
Within the implementing agency, as the level of management changes, the level of detail of the indicators may
change. A field manager, ... of the new areas of work identified was performance management systems. The
DAC Secretariat agreed to lead and co-ordinate the work.
The topic of performance management, or results based management, ... resource accounting and budgeting. In Australia the main driver for change was the
introduction of Accruals-based Outcome and Output Budgeting. In Canada, the Office of the Auditor General
and the...
- 158
- 572
- 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
Ngày tải lên :
07/03/2014, 15:20
... autoradiographed. Competitor DNAs
used in EMSA analysis were: NF1 wt, 5¢-TTTTG
GATTGAAGCCAATATGATA-3¢;NF1mut,5¢-TTTT
GGATTGAATAAAATATGATA-3¢;Site-2wt,5¢-GCGT
CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT
TGTCC-3¢;Site-2mut,5¢-GCGTCTCACCCTAGTAA
TGGTAATGCTCCAAGGGTTTTTGTCC-3¢;Site-3wt,
5¢-GGGTTCTTTTGGCATCCCTGTAGC-3¢;Site-3mut,
5¢-GGGTTCTTTTTAAATCCCTGTAGC-3¢.
Chromatin ... gene and 2 lg of control
luciferase plasmid DNA (pGL3, Promega) were used for
transfection. CAT and luciferase activities were measured as
described [17].
DNase I protection assay
Rat liver and ... [13].
Site-2 and Site-3 binding activity in all fractions was
monitored by the in vitro DNase I protection assay. The
DNA affinity column, used as the last step in the
purification, was prepared with an...
- 8
- 426
- 0
Báo cáo " The development of financial systems of ASEAN-5 and Vietnam: A comparative analysis " potx
Ngày tải lên :
14/03/2014, 17:20
...
As far as the development of financial scale
is concerned, the ASEAN-5 financial systems
were about ten times as large, with the total
financial assets of 80% of GDP on average. In
Vietnam, ... by the Basel I ratios of
regulatory capital to risk-weighted assets and the ratio of
market capital to risk-adjusted assets) could reflect the
financial position of banks. As regards the capital ... of
ASEAN-5. Besides, the structure of the
economy of both ASEAN-5 and Vietnam has
changed towards industrialization. It could be
seen that the share of manufacturing of
ASEAN-5 on average...
- 13
- 505
- 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot
Ngày tải lên :
15/03/2014, 00:20
... respectively, was
obtained by PCR with the following oligonucleotide prim-
ers: 5¢-TGAATTC
AATAATGTCTAACTTCCGCGCTCT-
GTTC-3¢ and 5¢-AGGTACCTCAATGATGATGATGAT
GATGATGCAGTGACGCGCACGTAGA-3¢. For the suc-
cessful ... levels of pathogenesis-related proteins 1a were
not significantly different in ParA1 and PR treatment.
Cytosolic ascorbate peroxidase was upregulated in all
treatments, whereas catalase was only ... Hitachi, Tokyo,
Japan). On the basis of the absorbance value, the standard
curve (obtained by adding the concentration gradient of
H
2
O
2
) and the loaded weight of plant tissue, the content of
H
2
O
2
was...
- 15
- 479
- 0
Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc
Ngày tải lên :
18/03/2014, 01:20
... Rac2
and S10 0A9 .
Assay of NADPH oxidase activity after
oxidase activation
The dormant NADPH oxidase of neutrophil membranes
was activated by mixing neutrophil plasma membranes and
the recombinant cytosolic ... GTPcS-loaded Rac2, MgSO
4
and an optimal
amount of arachidonic acid determined for each assay of
oxidase activation [12]. The rate of O
2
–
production by the
activated NADPH oxidase was calculated ... dismutase. NADPH
oxidase activity was also assayed by polarographic meas-
urement of the rate of O
2
uptake at 20 °CwithaClark
electrode at a voltage of 0.8 V. All experiments were carried
out at...
- 10
- 396
- 0
Báo cáo khoa học: A guide to taming a toxin – recombinant immunotoxins constructed from Pseudomonas exotoxin A for the treatment of cancer ppt
Ngày tải lên :
22/03/2014, 15:21
... PE38) has undergone
several early-phase clinical trials for the treatment of B
cell malignancies [35–37]. These trials have validated
the use of CD22 as a target and highlighted several
potential ... outside of PE and its
intoxication pathway. Target selection and the target-
ing element are at least as important as the toxin por-
tion of RITs. The ability of a RIT to discriminate
between normal ... for the treatment of various leuke-
mias and lymphomas. The anti-CD25 RIT LMB-2 has
undergone a phase I clinical trial [43] showing an over-
all response rate of 23% (8 ⁄ 35), and there are at...
- 18
- 528
- 0
Food, Nutrition, Physical Activity, and the Prevention of Cancer: a Global Perspective doc
Ngày tải lên :
22/03/2014, 16:21
... cent of cases occur in
China alone.
94 97
High-risk areas are China, Japan, eastern
Europe, and Central and South America. Low-risk areas are
South-East Asia, northern and eastern Africa, the USA, ... elegance of the process was one of the many attractions to me of assuming the role
of chair of the Panel. I could pretend that it was the major reason, and in a way it was, but
the first reason was enjoyment. ... not cancer. What I described
as my ignorance, WCRF International kindly labelled impartiality.
WCRF also appreciated the parallels between dietary causes of cardiovascular disease
and cancer. There...
- 537
- 877
- 1
Báo cáo khoa học: "Current Research in the Development of a Spoken Language Understanding System using PARSEC*" ppt
Ngày tải lên :
23/03/2014, 20:20
...
a developing picture of the structure and mean-
ing of a sentence. The CDG grammar has a weak
generative capacity which is strictly greater than
that of context-free grammars and has the added ... addition of the link nodes
in the grammar.
2 Constraint
Grammar
Dependency
Instead of using context-free grammars, we are
using a natural language framework based on the
*Parallel Architecture ... all the remaining words in the
sentence or no words at all. Each of the arcs
in the network has associated with it a matrix
whose row and column indices are the roles that
the words can play...
- 2
- 359
- 0