curriculum development as a response to the needs of the society

Báo cáo " Self-regulated strategy development as a means to foster learner autonomy in a writing course " pdf

Ngày tải lên : 28/03/2014, 11:20

... effectiveness of the task. - Scope: The evaluation is internal, i.e. evaluating the task against the stated objectives/goals. - Evaluators: The teacher and the students directly involve in evaluating ... goals, a 6-stage procedure for SRSD is adapted from the literature on SRSD (e.g. Graham and Harris [19]; Mason, Harris and Graham [18]; Harris, Graham and Mason [20]; Chalk, Hagan-Burke and ... for each of the major terms that are going to be used in this paper. Definitions of learner autonomy have been varied (Littlewood [1]). However, the basis of autonomy has always been the ability...

8
518
4

Authoring and Generating Health-Education Documents That Are Tailored to the Needs of the Individual Patient doc

Ngày tải lên : 22/03/2014, 15:21

... that this was relevant to the particular patient. 3 Representing a Tailorable Document 3.1 Finding an Appropriate Level of Abstraction As explained above, a master document is a specification of ... Each leaflet was tailored to the recipient, taking into account such characteristics as reasons for smoking or belief in the efficacy of mam- mography; this information had been asked of each patient ... alternative requires a human and an authoring tool. The creator of a master document would normally be a professional medical writer, who will need to understand the nature of tailored and tailorable texts,...

12
379
0

Báo cáo khoa học: The hyperﬂuidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx

Ngày tải lên : 07/03/2014, 12:20

... shown to increase HSF1 activity. Enhanced Ras maturation by heat stress was associated with a heightened activation of extra- cellular signal-regulated kinase (ERK), a key mediator of both mitogenic ... typical scenario, the activation of growth factor receptors may in turn activate the Ras ⁄ Rac1 pathway, which has been shown to play a critical role in HSF1 activation and HSP up-regula- tion ... stress response: characterization of changes in cytoplasmic organelles, cytoskeleton, and nucleoli, and appearance of intranuclear actin ﬁlaments in rat ﬁbroblasts after heat-shock treatment....

10
452
0

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

Ngày tải lên : 22/03/2014, 12:20

... July and January,respectively. Quang Tri has a total annual rainfall of about2000‐2700mm, but the rainfallisrather unequally distributed over time and space. The rainyseasonstartsinSeptember,endsin NguyenTienGiangetal./VNUJournal of Science,EarthSciences24(2008)66‐78 ... which are important  to find a measure,or a combination of measuresthatis suitable for all the actors. Thirdly, all of the suggested criteria have to meet the demand of ... *Correspondingauthor.Tel.:84‐4‐2173940. E‐mail:giangnt@vnu.vn As regardstopography,QuangTrihasall types of topography: mountains, hills, plains and coastal sand dune with two main river systems: Thach Han and...

13
487
0

Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"

Ngày tải lên : 02/11/2012, 11:12

... was not even noted in the index in the 1918 volumes of the Journals of the American Medical Association. Influenza was not a reportable disease: the only evidence of the early occurrence was ... following hypothesis what had happen to the influenza when it went to France. The first theory that was offered was that this “Spanish flu” was actually a different disease. Decades later phylogenic ... transmitting the avian influenza is not proven either. One, how does an intestinal virus change to that of a respiratory airborne-virus that is adapted to the mammalian lung? Second, the...

4
520
0

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Ngày tải lên : 19/02/2014, 17:20

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for ampliﬁcation of pyk. The resulting PCR prod- ucts, containing ... We then inserted the leader mRNA from the L. lactis ald gene as follows. A PCR fragment was generated using primer CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ ... signiﬁcantly as the PK activity was modulated. At increased PK activity we found an almost proportional increase in formate and acetate production and a decrease in lactate produc- Fig. 2. Modulation of...

12
616
0

The Future of Justification: A Response to N. T. Wright pptx

Ngày tải lên : 06/03/2014, 11:20

... imperial announce- ment was “that the crucified Jesus of Nazareth had been raised from the dead; that he was thereby proved to be Israel’s Messiah; that he was thereby installed as Lord of the ... exposition of Romans 3:25–26. To appreciate the boldness and sig- nificance of what he says in these wishy-washy days when pastors and scholars are afraid to teach with forthrightness and clarity the ... interpretation of Paul. What Saint Paul Really Said: Was Saul of Tarsus the Real Founder of Christianity? (Grand Rapids, MI: Eerdmans, 1997), 12–19. The same story can be told of the ever-changing...

240
1.1K
0

the dead poet that kill himself a response to dead poets s

Ngày tải lên : 21/03/2014, 22:53

1
277
0

Antibody response to influenza vaccination in the elderly: A quantitative review doc

Ngày tải lên : 28/03/2014, 20:20

... expect bias due to mis- classification of age, because age was a selection criterion in the papers we reviewed. Also, our OR measurements may not be a perfect measure of relative risk and may exagger- ate ... with a mean age above or below 75, as a best proxy for age. In univariate and multivari- ate analysis, there was a significantly lower response in those over 75 years of age, suggesting that Ab response ... were seroprotected before vaccination, although these differences were not always statistically significant. In univariate analysis, age had a significant impact on the response tovaccinationas measuredby seroconversion,...

11
484
0

Báo cáo khoa học: "A Response to the Need for Summary Responses" pdf

Ngày tải lên : 31/03/2014, 17:20

... description of the attributes, these frames indicate the nature and range of the attribute's potential values. The expected range of values that an attribute may assume is helpful to the range ... Generation of summary responses has important implications if the interactions with a database management system are to have the properties and constraints normally associated with human dialogue. ... to adapt to the requirements of a new user or database domain. For performance enhancement, the knowledge base may be augmented with an additional component for storing away the results of...

5
430
0

the community development handbook a tool to build community capacity

Ngày tải lên : 27/05/2014, 07:47

... community to act; ■ the ability to communicate and an openness to the ideas of others; ■ the ability to motivate others and share power; ■ the energy to initiate and sustain action; ■ an openness to ... development. It takes capacity to do this as well as good leadership, a viable plan, motivation and the support of the community. Basically, it takes capacity to build capacity, and it takes a well-thought-out ... that are available. Organizations and individuals can take on the role of community development catalyst as either volunteers or as part of their paid role or mandate. Some communities often...