create a website that will serve as a marketing vehicle for the consulting firm and integrate the founder s content leadership efforts

THAI FUNERAL RITE RITUAL PROCESS TO CREATE a NEW LIFE FOR THE DEAD (THAI FUNERAL IN PHU YEN, SON LA)

Ngày tải lên : 18/05/2016, 07:42

... fails to take the dead across the passages or places stipulated in Thai customs (inadequate oration of passages in the funeral chant), it is believed that the soul of the dead could not come to the ... water two rice seasons naturally The Thai people are as same as the Muong people in that they often drink alcohol firstly and take rice as additional dishes finally in a meal with guest Normally ... daughters-in-law and sons-in-law of the dead must support parents-in-law until they die; they must be good supporting daughters-inlaw and sons-in-law so that the dead salvation is easy Tui khut,...

27
434
0

developing a marketing plan for the keywordz service of gapit communication joint-stock company

Ngày tải lên : 08/01/2015, 12:41

... related content such as mobile personalization and entertainment items such as ringtones, graphics, and games Broadly, defined, Mobile marketing also encompasses various applications such as localized ... identified markets The marketing plan can and should be an essential document for organizational success The marketing plan is also an operational document that is created at the business level of the ... understand about the current location, the target markets, and competitors in the market First, an organisation needs to assess its present situation This assessment will explore the realities of...

87
538
0

Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

Ngày tải lên : 15/12/2013, 06:15

... imprints a chance to be expressed constructively so that we can release all the pent up energies we hold inside us - energies that can manifest physically as illnesses and emotionally as fear, anger, ... Staniforth, the creator of Sculptor 3, an amazing software that can make affirmations work for anyone, has this to say about affirmations: “By definition, an affirmation is a statement repeated ... The last three are in the physical realm 37 GREAT SOULS HAVE WILLS; FEEBLE ONES HAVE ONLY WISHES DESIRE No transformation can occur without a strong desire for success That is why the “mass of...

59
770
3

How to create a bootable USB for linux

Ngày tải lên : 13/02/2014, 00:59

1
496
0

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Ngày tải lên : 07/03/2014, 10:20

... metal dyshomeostasis in all aspects is clear In the AD affected brain, metal dyshomeostasis is evident in the form of a substantial increase in the levels of extracellular metals and a decrease ... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... 165–177 15 Takahashi S, Takahashi I, Sato H, Kubota Y, Yoshida S & Muramatsu Y (2001) Age-related changes in the concentrations of major and trace elements in the brain of rats and mice Biol Trace Elem...

9
634
0

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Ngày tải lên : 23/03/2014, 15:21

... merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae ... that a glaucophyte, C paradoxa that has the most primitive plastids [23], contained the PsbV and PsbU proteins as the extrinsic proteins (Figs and 2) A primitive red alga, C caldarium that has ... eukaryotes that possess a special type of plastid called cyanelle The cyanelle is surrounded by a peptidoglycan wall [20] and possesses a central body that resembles a cyanobacterial carboxysome...

11
501
0

Báo cáo khoa học: Sugar and alcohol molecules provide a therapeutic strategy for the serpinopathies that cause dementia and cirrhosis pot

Ngày tải lên : 30/03/2014, 11:20

... pathology that underlies this conformational transition is now well deﬁned and has been used as a paradigm for other diseases that result from aberrant b-strand linkage and tissue deposition [34,47] These ... These include Alzheimer s disease, Huntington s disease, Parkinson s disease and the amyloidoses As such, interventions that are effective in blocking b-strand linkages in one of these disorders ... data argue that small molecules are able to bind speciﬁcally to wild-type and mutant serpins and slow down conformational transitions They have no effect on association rate constants as the...

13
494
0

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Ngày tải lên : 18/06/2014, 16:20

... underway to assess the effects and benefits of this double therapy Combination therapy with cellular infusion The idea of cellular therapy has also been examined The major challenge in this case is ... these studies suggest that T1 D onset is associated with a loss of Treg cells numbers or /and function [37-42] Several findings suggest that IL-2/IL-2R signaling is necessary for the peripheral ... evidence shows that IL-2, as well as other common gamma chain (gc; also known as CD132) signaling, are important stimulatory signals for the development, function and fitness of nTreg cells Its signaling...

12
573
0

báo cáo khoa học: " Surface electromyography as a screening method for evaluation of dysphagia and odynophagia" ppt

Ngày tải lên : 11/08/2014, 20:20

... this water as normal" The main test is a single water swallow as normal Saliva swallow might be very important test in case of salivary glands diseases like, for example, Sjögren syndrome Stress ... has low level of discomfort, simple, time-saving and inexpensive With proper standard technique and established normative database surface SEMG can serve as a reliable screening method for assessment ... http://www.head-face-med.com /content/ 5/1/9 Suggestions for protocol application As it was mentioned above, the act of swallowing is described as consisting of four stages, as the oral stage was divided into oral initial (for solids...

11
315
0

Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy

Ngày tải lên : 09/09/2015, 18:56

... trials for genetic diseases such as sickle cell, β-thalassemia and multiple sclerosis (Trounson A et al., 2011) Autologous adipose stem cells and the stromal vascular fractions are being used for ... primers as follows: was performed using the forward and reverse CodA, GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA -3’ (reverse), size:1.2kb; Fcy 5’-AGGAATTCATGGTGACAGGGGGAATG ... Total RNA was isolated from plated embryoid bodies on day for RT-PCR analysis 3.2.2 Alkaline phosphatase staining msiPS cells were evaluated for alkaline phosphatase (AP) activity using the AP substrate...

134
439
0

Development of bordetella pertussis as a live vehicles for heterologous antigens delivery, and its application as a universal influenza a vaccine

Ngày tải lên : 11/09/2015, 10:00

... of approximately million deaths The recent spread of HPAI H5N1 virus across Asia and parts of Europe and the Middle East, as well as the occasional infections of humans with an overall fatality ... Professor Kemeny s lab, especially Richard, Benson, Kenneth and Yafang; friends in Associate Professor Fred Wang s lab and Associate Professor Herbert Schwarz s lab; as well as all those who have helped ... vaccines which target respiratory pathogens such as influenza viruses Several heterologous antigens from various bacterial pathogens have been successfully expressed in B pertussis and the nasal administration...

258
303
0

Lactobacillus as a vaccine vehicle for therapy

Ngày tải lên : 11/09/2015, 10:06

... Coeliac disease and Crohn s disease As a result, the usual response to harmless gut antigens is the induction of local and systemic immunological tolerance, known as oral tolerance (Strobel et al ... enterocolitica are successfully used as attenuated mucosal pathogens in animal models Table 1.1 shows the list of some attenuated pathogenic bacteria used as vaccine vehicles Commensal microorganisms, Streptococcus ... Tissue (BALT) and Nasopharyngeal Associated Lymphoreticular Tissue (NALT) The GALT is comprised of the Peyer s patches (PP), the appendix, and the solitary lymphoid nodules The tonsils and adenoids...

216
325
0

A WEB APPLICANTION FOR THE TOURISM INDUSTRY IN HANOI by Dinh Huu Son

Ngày tải lên : 07/04/2013, 23:51

... from spreadsheets and other databases and is the easy way to find answers, share information over intranets and the Internet, and build faster business solutions Corporate Web pages Sales figures ... Internet and its associated management issues To make it easy for people to use the network, hosts were assigned names, so that it was not necessary to remember the numeric addresses Originally, there ... creating and managing Web sites and pages Because it incorporates all of Dreamweaver 's page design and site management tools, UltraDev makes it easy to create, manage, and edit cross-platform,...

67
472
0

Conventional Providing a Uniform Law for Bill of exchange and Promissory Notes

Ngày tải lên : 22/10/2013, 10:15

... himself as a party to the bill and, if he pays, has the same rights as the person for whom he purported to act The same rule applies to a representative who has exceeded his powers Article The ... on the other parts Nevertheless, the drawee is liable on each accepted part which he has not recovered An endorser who has transferred parts of a set to 256 different persons, as well as subsequent ... sum payable shall be calculated according to a rate expressed in the bill The foregoing rules shall not apply to the case in which 148 the drawer has stipulated that payment must be made in a...

37
673
0

A general framework for studying class consciousness and class formation

Ngày tải lên : 01/11/2013, 07:20

... analysis: class structure, class location, class interests, class experiences, class consciousness, class formation, class practices and class struggles Some of these concepts, especially class structure, ... formations and class structures Let us look at each of these connections Class structure 7limits? class formation To say that class structures impose limits on class formations means that the class ... for explaining aspects of class consciousness and class struggle To count as an aspect of class consciousness, then, the belief in question must both have a class content and have class-pertinent...

31
500
0

Tài liệu Machinery''''s Handbook 27th Edition A REFERENCE BOOK FOR THE MECHANICAL ENGINEER, docx

Ngày tải lên : 15/12/2013, 03:15

... numbers that, in fact, are less than 0, and these are called negative As these numbers must be expressed by the same figures as the positive numbers they are designated by a minus sign placed before ... editors has always been to create a comprehensive and practical tool, combining the most basic and essential aspects of sophisticated manufacturing practice A tool to be used in much the same way that ... terms of thousandths rather than tenths or hundredths So a decimal fraction of 0.2 is expressed as 200 thousandths, not tenths, and a value of 0.75 is expressed as 750 thousandths, rather than...

3.3K
636
2

Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx

Ngày tải lên : 23/01/2014, 07:20

... on a PC is that there are a wide variety of devices available for the PC platform, as opposed to the UNIX platform This also has an important practical advantage in that a much Fig 14.2 VR system ... desktop systems, they typically require the user to wear the lightweight LCD glasses and use standard position trackers to track the user 's head and hand position Examples of this approach are ... Such systems are adequate for tasks where immersion is not essential, such as CAD For interaction with the 3D world, devices like the Spaceball and/ or gloves can be used Since desktopbased VR...

10
634
1

Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

Ngày tải lên : 14/02/2014, 13:20

... diseases such as cardiovascular disease, type II diabetes, osteoporosis and depression, and contributes to maintaining muscular strength in older age 15 To maintain cardiovascular health, the ... the awareness of the potential which healthy dietary habits and physical activity have for reducing the risk for chronic diseases amongst decision makers, health professionals, the media and the ... urban planning policies can ensure that walking, cycling and other forms of exercise are easy and safe, and address non-motorised modes of transportation The provision of safe cycling and walking...

22
703
0

Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf

Ngày tải lên : 16/02/2014, 06:20

... s) Again we shall use the same random walk paths A for all the full-state processes and the half-space processes, so that these processes are automatically coupled We shall denote the full-space ... of Step 1, and Step formulates the meaning of ‘at least as large’ here as a precise probability estimate Step and Lemma then prove that this probability estimate indeed holds It is for this estimate ... take s0 so large that( 3.91) holds under (3.30) For (3.92) we took t = s, so that this holds as soon as s ≥ s0 Fortunately there is a simple replacement for (3.91) that holds as soon as s0 ≤ s ≤...

67
490
0