corn apples and other feed is used to attract deer for viewing at some resort areas an
Tài liệu In this lab, 2 ISDN routers are required. If ISDN routers are not available, review the lab to become familiar with the process. An Adtran Atlas550 ISDN emulator is used to simulate the switch/ISDN cloud. pdf
Ngày tải lên :
21/12/2013, 19:15
... mechanism for the interface to simulate an active state for internal processes, such as routing, on the router The show interface command can also be used to display information about the B channel: ... contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface 8-8 CCNA 4: WAN Technologies ... used, when needed Create a Dialer Pool, and put the interfaces and the associated Dialer Profiles in a common pool The commands for doing this are as follows: Tokyo(config-if)#interface bri Tokyo(config-if)#dialer...
- 8
- 419
- 0
Tài liệu She is used to getting up late in cold weather pot
Ngày tải lên :
26/02/2014, 00:20
... biết thêm chi tiết từ đó) She is used to getting up late in cold weather 2 Các bạn di chuột vào cụm từ để biết chức cụm câu: She is used to getting up late in cold weather 3 Tại câu lại dịch vậy? ... câu - is used to getting up late” - quen với việc dậy trễ Đây động từ (verb) câu Trong is used to trợ động từ (auxiliary) “getting up” động từ câu (main verb) Cấu trúc câu to be used to + V-ing” ... *She is used to getting up late in cold weather Hình thức ngữ pháp : Cấu trúc câu "to be used to + V-ing " (Thói quen tại) Chúng ta quan sát câu sau Các bạn di chuột...
- 5
- 703
- 0
Semantics Semantics is the study of meaning that is used to understand human expression through language.
Ngày tải lên :
13/07/2014, 23:26
... Semantics is the study of meaning that is used to understand human expression through language Semantics is perhaps the most difficult part of the grammar of a language to learn What is “semantics”? ... headword and using the symbols ‘+’ and ‘-’ to say if the word contains that feature There is no list of semantic features We need the context to create one Semantic features Man Woman Girl Click to ... Language is arbitrary It is arbitrary because the relationship between forms and their meanings are sometimes can not logically proved Although a form can have more than one meaning, there is...
- 26
- 954
- 2
Báo cáo khoa học: MPP3 is recruited to the MPP5 protein scaffold at the retinal outer limiting membrane ppt
Ngày tải lên :
16/03/2014, 13:20
... ACAAAGACCATGACGGTGATTATAAAGATCATGAC ATCGATTACAAGGATGACGATGACAAGCTCATG-3¢ (sense), and 5¢- GTACAGCTTGTCATCGTCATCCTTG TAATCGATGTCATGATCTTTATAATCACCGTCATGG TCTTTGTAGTC-3¢ (antisense), and ligated into ... similar to the corresponding preimmune yolk and was not used for further immunohistochemical studies (data not shown) Immunohistochemistry and confocal laser scanning microscopy were used to determine ... MPP3DGuK-FLAG (lanes and 4) Note that endogenous MPP5 can be detected as 70 kDa band in cell lysates, but upon coimmunoprecipitation with MPP3 it is visible as double band of 70 and 80 kDa, due to enrichment...
- 14
- 449
- 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot
Ngày tải lên :
18/06/2014, 22:20
... the original variant TUL02 seems to be sufficient for transmission of a recombinant virus, in a hypothetical in vivo situation, from one rodent to another If transmission is performed in a samplinglike ... with primers RECF738 and RECR855 Lines and show negative controls M, molecular weight marker; bands of 147 and 110 bp are indicated by arrows and the N protein of Tula hantavirus (TULV) Most ... samplinglike fashion – and this seems to be the case for hantaviruses [13] – the recombinant would have fair chances to survive The existence of wt recombinant strains of TULV [10] supports this way of reasoning...
- 5
- 483
- 0
báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt
Ngày tải lên :
20/06/2014, 04:20
... the original variant TUL02 seems to be sufficient for transmission of a recombinant virus, in a hypothetical in vivo situation, from one rodent to another If transmission is performed in a samplinglike ... with primers RECF738 and RECR855 Lines and show negative controls M, molecular weight marker; bands of 147 and 110 bp are indicated by arrows and the N protein of Tula hantavirus (TULV) Most ... samplinglike fashion – and this seems to be the case for hantaviruses [13] – the recombinant would have fair chances to survive The existence of wt recombinant strains of TULV [10] supports this way of reasoning...
- 5
- 430
- 0
Báo cáo y học: "Cis-regulation of IRF5 expression is unable to fully account for systemic lupus erythematosus association: analysis of multiple experiments with lymphoblastoid cell lines" doc
Ngày tải lên :
12/08/2014, 15:23
... the analysis Expression data were transformed into standardised normal distributions (that is, expression data from each probe were transformed into new variables with mean = and standard deviation ... regulatory factor gene; LCL = lymphoblastoid cell line; CEU = European population from International HapMap Project database; KSC = average of standard normal transformed K8, S and C data Statistical ... or activation status However, it is important to note that no significant cis-regulation for IRF5 isoforms has yet been reported, in spite of its many splice variants and their upregulation in...
- 12
- 355
- 0
Báo cáo khoa học: "SOFA is superior to MOD score for the determination of non-neurologic organ dysfunction in patients with severe traumatic brain injury: a cohort study" doc
Ngày tải lên :
13/08/2014, 02:24
... respiratory failure This again suggests little additive contribution Discussion Brain injury is a pro-inflammatory state that may be an important mechanism of organ dysfunction and ultimately ... database ICU patients, Zimmerman and coworkers [19] found that a continuous physiologic measure is a more sensitive and accurate method for describing patients and estimating outcome than total scores ... performed the analysis and wrote the manuscript All authors edited and approved the final manuscript 10 11 12 Acknowledgements Thank you to Christi Findlay, Reza Shahpori, and Dean Yergens for...
- 10
- 388
- 0
The use of theme-based short readings to improve vocabulary for freshmen at Hanoi Medical College = sử dụng các bài đọc ngắn theo chủ đề nâng cao vốn từ vựng ch
Ngày tải lên :
30/03/2015, 14:30
... sentences are used for listening and speaking, and the words which we recognize and use for reading and writing can be identified as written vocabulary The words that we use to write and speak are ... usually related to pleasure, information, and general understanding and are determined by the nature of the material and the interest of the students Students are encouraged to read for a variety ... and their attitudes towards theme based short readings In addition, such methods as descriptive, analytic, comparative and contrastive were also utilized to describe and analyze, to compare and...
- 78
- 551
- 1
Language Teaching Strategies and Techniques Used to Support Students Learning in a Language other than Their Mother Tounge
Ngày tải lên :
12/08/2016, 19:37
... instructions and what learners had been asked to Language learners “…actively try to make sense, i.e to find and construct a meaning and purpose for what adults say to them and ask them to do” (Cameron ... that is meaningful to them (Williams and Burden 1997), students may need support in finding ways of constructing links and communicating their understanding and experiences to others (Bennett and ... comfortable and relaxed and possibly reduce the anxiety related to attempting the target language (Hill and Flynn 2006) Elaborated Input During lessons, some teachers used Elaborated Input, that is the...
- 16
- 580
- 0
Is complementary and alternative medicine (CAM) used to combat medical costs a study of consumers, medical professionals, and a CAM practitioner
Ngày tải lên :
03/11/2016, 21:07
... dedicate this to my parents, grandparents, and great-grandparents for always supporting and encouraging my education Thank you Mom, Dad, Grandma Smith, Grandpa Smith, Grandma K, Grandpa K, Grandma ... business and economic leader During this time period, pharmaceutical companies lobbied for changes in drug regulations and approvals, became more involved with and in touch with patient demands, and ... values Capitalism in the U.S is unique compared to other capitalist nations, and the economic system can be described both as laissez-faire capitalism and free-market capitalism (Bradley and Donway...
- 125
- 422
- 0
Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx
Ngày tải lên :
20/01/2014, 20:20
... www.petersons.com/publishing to see if there is any new information regarding the test and any revisions or corrections to the content of this book We’ve made sure the information in this book is accurate and up -to- date; ... that you answer The algorithm used to build a score is more complicated than that This means that you can make a silly mistake and answer incorrectly and that the computer will recognize that ... margin as any candidate in the state’s history (C) having been reelected with as wide a margin as any candidate in the state’s history (D) she was reelected with as wide a margin as any candidate in...
- 696
- 1K
- 1
Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc
Ngày tải lên :
15/03/2014, 00:20
... untreated Ure2p and Ssa1p is seen in lanes and 10 Ure2p, Ssa1p and Ure2p incubated with Ssa1p treated with BS2G are seen in lanes and 8, and 11 and and 13, respectively Similar samples treated ... [12]) with a mass tolerance of p.p.m We therefore used MALDITOF-TOF and ⁄ or nanoLC-Orbitrap tandem MS to further identify peptides from this list Twenty-five mono-linked peptides and five loop-linked ... moiety of Ure2p, which is critical for assembly An alternative explanation that can account for this observation is that Ssa1p binds with higher affinity a conformational state of Ure2p as a result...
- 12
- 510
- 0
Báo cáo khoa học: A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P3 and PtdIns(3,5)P2 pptx
Ngày tải lên :
23/03/2014, 07:20
... protein in crude membrane fractions with anti-PCaP1 Lanes and 6, A thaliana; lanes and 7, Raphanus sativus; lanes and 8, Brassica rapa; lanes and 9, B rapa var glabra; lanes and 10, B oleracea var ... possible candidate for N-myristoylation exists at the N-terminal region, as described later PCaP1 has many Ser and Thr residues, and some residues have been estimated to be phosphorylation sites ... membrane (Fig 4) Third, [3H]myristic acid was incorporated into PCaP1, but not into a PCaP1G2A mutant (Fig 5) Thus, we conclude that PCaP1 is myristoylated at Gly2 and that cotranslational myristoylation...
- 16
- 424
- 0
How Is Deployment to Iraq and Afghanistan Affecting U.S. Service Members and Their Families potx
Ngày tải lên :
23/03/2014, 08:20
... taps RAND expertise in both defense and health policy to conduct research for the Department of Defense, the Veterans Administration, and nonprofit organizations RAND Health aims to transform ... Veterans of Iraq and Afghanistan Tanielian and Jaycox, 2008: Invisible Wounds of War: Psychological and Cognitive Injuries, Their Consequences, and Services to Assist Recovery Combat operations ... buildings, an unidentified and constantly changing enemy, and unforeseen obstacles 13 14 How Is Deployment to Iraq and Afghanistan Affecting U.S Service Members and Their Families? Figure 3.1 Traumatic...
- 62
- 341
- 0
The Future Isn’t What It Used To Be Changing Trends And Their Implications For Transport Planning doc
Ngày tải lên :
23/03/2014, 10:20
... Implications For Transport Planning Victoria Transport Policy Institute Keith T Lawton (2001), The Urban Structure and Personal Travel: an Analysis of Portland, Oregon Data and Some National and ... grocery store, and is happy to be saving money and not polluting the planet 14 The Future Isn’t What It Used To Be: Changing Trends And Their Implications For Transport Planning Victoria Transport ... Trends And Their Implications For Transport Planning Victoria Transport Policy Institute Benefits of Responding To Changing Travel Demands Planning reforms that respond to these changing demands can...
- 42
- 474
- 0
Báo cáo khoa học: Caspase-2 is resistant to inhibition by inhibitor of apoptosis proteins (IAPs) and can activate caspase-7 pot
Ngày tải lên :
23/03/2014, 13:20
... GTCAACAACGG-3¢; 33, 5¢-GAGAATTCTCAGTCCAT CCCATTTCTGGC-3¢ Yeast transformation and death assays Saccharomyces cerevisiae strain W303a was used in all yeast transformation and death assays, as described ... Caspase-2 can activate caspase-7 and is resistant to IAPs Fig Schematic illustration of the caspase2 proteins used in this study Mutated residues are listed above wild-type caspase-2 and are depicted ... Caspase-2 can activate caspase-7 and is resistant to IAPs Discussion A unique merit of the yeast system used here is that it is free from the potential interference of other mammalian apoptotic signal...
- 14
- 348
- 0
Báo cáo sinh học: "Bisphosphonate-associated osteonecrosis of the jaw is linked to suppressed TGFb1-signaling and increased Galectin-3 expression: A histological study on biopsies" pot
Ngày tải lên :
18/06/2014, 19:20
... established the immunohistochemistry, analyzed the tissue samples, interpreted the data, and performed the histopatholgic analysis of BRONJrelated and control tissue samples All authors read and ... method and an automated staining device (Autostainer plus, DakoCytomation, Hamburg, Germany) We used the standard protocol recommended for the staining kit (Dako Real, Cat K5005, DakoCytomation) ... initials are used FW applied for grant support (ELAN-Fonds, University of Erlangen), initiated and conducted the study, formulated the hypothesis, established and conducted the methods and analytic...
- 11
- 416
- 0
Báo cáo hóa học: " Validated instruments used to measure attitudes of healthcare students and professionals towards patients with physical disability: a systematic review" pdf
Ngày tải lên :
19/06/2014, 08:20
... generated the items from discussions with an expert panel of nurses, occupational and physical therapists, and psychologists The instrument has face and content validity [39] and has been found to ... face, content, and discriminant and responsiveness validity [31] Attitudes Toward Physically Disabled College Students (ATPDSC) Rehabilitation Situations Inventory (RSI) ATPDSC assesses attitudes ... practicing physicians in California and found that 22% had not received training in disabilities and acknowledged a need for such training[15] A recent survey of dental and medical educoator and students...
- 7
- 647
- 0
Báo cáo hóa học: " Abnormal coactivation of knee and ankle extensors is related to changes in heteronymous spinal pathways after stroke" pot
Ngày tải lên :
19/06/2014, 08:20
... 5.0 platform (National Instruments) and stored on computer for later analysis Experimental protocol for coactivation assessment Prior to each task and to any data collection, all participants ... oscilloscope and stored on computer for off-line analysis Experimental protocol for evaluation of the modulation Participants were instructed to press with the forefoot on the fixed platform in order to ... France: PMC7 proceedings; 2009 Dyer JO, Maupas E, de Andrade Melo S, Bourbonnais D, Forget R: Abnormal coactivation of knee and ankle extensors is related to transmission changes in spinal pathways...
- 14
- 546
- 0