conditional 3 put the verbs in brackets into the a correct form
verbs in brackets
Ngày tải lên :
14/09/2013, 02:10
... neighbor(chat)………………………… with her over the fence(hang rao) the bell(ring)…………………………… while Tom(take)………………………… a bath when they came to the stadium, the match(already, begin)………………………………… they told me they ... they (get)…………………there, their friends (go)………………………… already After they (prepare)…………………………………everything for the dinner, all member in their family (sit)…………………………………around a table For the last ... (never watch) that TV programme 2/ We (watch) a good programme on TV last night 3/ He (read) that novel many times before 4/ He (read) that novel again during my last vacation...
- 13
- 774
- 3
A study of the linguistic features of suggestion verbs in english and their vietnamese equivalents
Ngày tải lên :
26/11/2013, 13:17
... linguists and researchers Quirk R et al in “ A Comprehensive Grammar of the English Language” [33 ] point out that SVs are followed by a thatclause containing the mandative subjunctive, putative should ... shows an intention or a plan In Vietnamese, the two verbs are interpreted as “ñ ngh ” and “ñ xu t” respectively Both these two cases share the same meaning the speaker asks to carry out an action ... out the syntactic characteristics of SVs in general and find out how to use these verbs in the sentence The Vietnamese linguists and researchers indicate the pragmatic features of SVs and their...
- 13
- 1.3K
- 5
The primary verbs in english and the errors make by students
Ngày tải lên :
18/12/2013, 21:45
... or the past participles or infinitive to form ordinary verbs, they are not added to the meaning of the main verbs But when they stand alone, they are the meaningful verbs The auxiliary verbs affect ... of certainty or obligation A modal verb is always the first word in the verb phrase It always has the same form and never has an ending such as: Infinitive (to may); -ing participle (maying) or ... that take the first importance of the auxiliaries, they are combined with lexical verbs to extend meaning of the main verbs, especially about time continuation.They appear in all tenses and they...
- 52
- 621
- 2
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf
Ngày tải lên :
18/02/2014, 08:20
... inhibitor into FVIIa and G372AFVIIa increased the afnity for sTF in an indistinguishable manner The differences and similarities between G37 2A- FVIIa and FVIIa seen in complex with sTF are presumably also ... which allows visualization of the modication using SDSPAGE The rate of carbamylation of the N-terminal amino group [Ile1 53( 16)] of the protease domain in G37 2A- FEBS Journal 276 (2009) 30 9 931 09 ... correct insertion of the N-terminal tail into the activation pocket To assess this hypothesis, we mutated Gly372(2 23) to Ala, a substitution that was not included in the published alanine scanning...
- 11
- 619
- 0
Tài liệu Báo cáo khoa học: "HOW DO WE COUNT? THE PROBLEM OF TAGGING PHRASAL VERBS IN PARTS" docx
Ngày tải lên :
20/02/2014, 21:20
... words These sentences were first tagged manually to provide a baseline and then tagged automatically using PARTS The a priori option of assuming only a verbal tag for all the pairs in question was ... actually degrades performance because in some cases the content word is a. lmost always a noun rather than a verb For example, a phrasal verb like box in generally appears with an intervening ... Computational Linguistics Using Large Corpora To appear in Computational Linguistics, 19 93 C Le raux On The Interface of Morphology & Syntax Evidence from Verb-Particle Combinations in Afi-ican...
- 3
- 516
- 1
Báo cáo khoa học: Regulation of arginase II by interferon regulatory factor 3 and the involvement of polyamines in the antiviral response potx
Ngày tải lên :
07/03/2014, 21:20
... 5¢-ACAATGAGCTGCTGGTGGCT -3 and 5¢-GATGGGCACAGTGTGGGTGA -3 ; murine b-actin, 5¢-TGGAATCCTGTGGCATCCATGAAAC -3 and 5¢-TA AAACGCAGCTCAGTAACCGTCCG -3 Human GAPDH primers were included in the Advantage ... lL (Advantage RT-PCR kit; Clontech, Mountain View, CA, USA), and 20 lL was used for PCR amplification using the following primers: human and murine ArgII, 5¢-GAT CTGCTGATTGGCAAGAGACAA -3 and 5¢-CTAAATTC ... Polyamine depletion inhibited TNF -a- induced JNK activation and subsequently prevented caspase -3 activation in intestinal epithelial IEC6 cells, thereby delaying TNF -a- induced apoptosis [38 ] As...
- 12
- 498
- 0
Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt
Ngày tải lên :
07/03/2014, 21:20
... hydratase 3- Ketoacyl-CoA thiolase Perilipin GGTTGT gtagg AGTTCA AGGACA a AGGTCA AGGTAG a AGGTCA TGCCCT t TCCCCC CAACCT t TACCCT GACCTA tt GAACTA t TACCTA AGACCT t TGAACC TCACCT t TCACCC – [54] [54] ... 5¢-dGAG AGGTACCGAGCAAGACTCTGTCTCAAA -3 , nucleotides )229 to )209) Prm3abc; pGL3b:Prm3abc (Primer Kin 236 , 5¢-dGAG AGGTACCCCGGAGAGGATATTTGAGCTG -3 , nucleotides )192 to )171) Prm3abe; pGL3b:Prm3abe ... sequence AGTTCA to ATTTTA centred at )148 within Prm3 was performed using the template pGL3b:Prm3ab in combination with the primers Kin275 (5¢-dGAAGGTTGTGTAGG ATTTTACCAGAGCTACTTACACTG -3 ; sense...
- 20
- 432
- 0
Báo cáo khoa học: Mechanism for transcriptional synergy between interferon regulatory factor (IRF)-3 and IRF-7 in activation of the interferon-b gene promoter docx
Ngày tải lên :
23/03/2014, 13:20
... of the IFN-b promoter, coactivators not only serve as an adaptor between the general transcription machinery and the activators, but also act as a scaffold by stabilizing the formation of a nucleoprotein ... conducted a systematic analysis of the domains within p300 and CBP that interact with mATF-2195 (the shorter murine activating form of ATF-2), c-Jun, p50, p65 and IRF-1, and the result of these experiments ... including flanking S/ MARs; the virus-responsive element (VRE) and the factors binding to it in the uninduced and virus-induced states are indicated (B) Activity of P31·2CAT and )110IFNbCAT in P19...
- 11
- 487
- 0
Verbs in the Written English of Chinese Learners: A Corpus-based Comparison between Non-native Speakers and Native Speakers potx
Ngày tải lên :
24/03/2014, 19:20
... that “There is clearly a need for more, and better quality, data and this is particularly acute in the case of natural language data” and “learner corpora are a valuable addition to current SLA ... be traced to EA It was generally maintained before the EA era, for instance in CA, that the learner’s errors are undesirable because they are a sign of non-acquisition Since the CA researchers ... submit their essays through digital form on computers and the raw data are automatically transferred into the corpus 17 2 .3. 3 Un-annotated vs annotated An un-annotated corpus, as we noted above,...
- 345
- 621
- 0
Báo cáo khoa học: "A CONSIDERATION ON THE CONCEPTS STRUCTURE AND LANGUAGE IN RELATION TO SELECTIONS OF TRANSLATION EQUIVALENTS OF VERBS IN MACHINE TRANSLATION SYSTEMS" doc
Ngày tải lên :
31/03/2014, 17:20
... equivalent ( D o , Play : ~ - & ) that can be associated in common to a part of the structure of the categories as in Fig.l, and then find appropriate translation equivalents in detail at the ... level categories (2) To each verb found in the process of the association, consults ordinary dictionary of translation equivalents and word usage of verbs and obtain the set of all the translation ... considerations of space size and realizability on actual data, because we have to check all the combinations of several ten thousands nouns with each verb (i) The only one natural conceptural categories...
- 3
- 394
- 0
Báo cáo khoa học: "Determining the placement of German verbs in English–to–German SMT" ppt
Ngày tải lên :
31/03/2014, 21:20
... the training data and extracted with the correct German phrase (but the German order is again incorrect) 6 .3 Collocations Collocations (verb–object pairs) are another case which can lead to a ... incorrectly In our translation, all verbs are translated and placed correctly Another problem which was often observed in the baseline is the omission of the verbs in the German translations The baseline ... subject any any any any any any clausefinal ∅ mainV ∅ mainV finV VC Table 1: Position of the German subjects and verbs in declarative clauses (decl), interrogative clauses and clauses with a peripheral...
- 10
- 514
- 0
Using JavaTM ME Platform to Put the Fun into Your Mobile Device and Cell Phone pdf
Ngày tải lên :
27/06/2014, 09:20
... Chapter 3, I’ll talk about the extra things you can on a GameCanvas But a GameCanvas is a subclass of Canvas, and a lot of the important functionality is already here There’s enough to draw a ... only the International Organization for Standardization (ISO) Latin range of characters from the Unicode standard, version 3. 0 For more information about character encoding in Java, see http://java.sun.com/ ... inside the JAR file contains a lot of the same information as the JAD file, and properties that appear in both must have identical values; otherwise (for security reasons), the application can’t...
- 422
- 346
- 0
USE THE CORRECT FORM OF THE WORDS IN BRACKETS pdf
Ngày tải lên :
21/07/2014, 21:20
... greatest (satisfy) I’m not sure at all I really can’t say with (certain) Travel is said to the mind (broad) Maradona is one of the best football in the world (play) The town is situated on the ... sure at all I really can’t say (certain) jobs in this company interest me very much A) Attraction B) Attractive C) Attractively D) Attracted I was ……… right when I said that the man was guilty ... keening She is _ in asking for bigger salary She has worked hard A) reason B) unreasonable C) reasonable D) unreasonably The patient is getting on _ A) satisfactorily B) satisfy C) satisfaction...
- 6
- 2.6K
- 21
Báo cáo y học: "Proteinase-3 as the major autoantigen of c-ANCA is strongly expressed in lung tissue of patients with Wegener’s granulomatosis" pptx
Ngày tải lên :
09/08/2014, 03:24
... phosphatase (APAAP) method (see later) Immunohistochemical double-labeling (APAAP method) Double-labeling was performed using the APAAP method, with monoclonal antibody against CD68 (macrophages ... human heart, brain, liver and lung tissue RNA size marker bands are indicated in the left margin of the blot (M) Supplementary Figure Proteinase -3 mRNA expression in macrophages and endothelial cells ... PR -3 in other organs or tissues that are involved in the manifestation pattern of WG [26] Schwarting et al showed the in vitro expression of PR -3 mRNA in tubular epithelial cells and glomerular...
- 7
- 370
- 0
Báo cáo y học: "Low-intensity pulsed ultrasound activates the phosphatidylinositol 3 kinase/Akt pathway and stimulates the growth of chondrocytes in three-dimensional cultures: a basic science study" pot
Ngày tải lên :
09/08/2014, 10:23
... between the PI3K/Akt pathway and Wnt/β-catenin signaling, LIPUS may activate β-catenin signaling via the PI3K/Akt pathway As indicated in Figure 4c,d, the nuclear localization of β-catenin, as a marker ... examined in this system, and the involvement of a mechano-transduction pathway via the integrin/mitogen-activated protein kinase (MAPK) pathway and of another signaling pathway via β-catenin was ... culture in the 3D system, the cartilaginous tissue in each specimen appeared thicker in comparison with week 1, and the volume of the extracellular matrix had also increased and formed a stable cartilaginous...
- 11
- 483
- 0
Báo cáo y học: "Ascaris worm in the intercostal drainage bag: inadvertent intercostal tube insertion into jejunum: a case repor" pps
Ngày tải lên :
10/08/2014, 09:23
... in the intercostal drainage bag: inadvertent intercostal tube insertion into jejunum: a case report Journal of Cardiothoracic Surgery 2010 5:125 Figure An Ascaris worm in the intercostal drainage ... tube placement in trauma care - which approach is preferable? Resuscitation 2007, 72(2):226 -33 Darbari A, Tandon S, Singh GP: Gastropleural fistula: Rare entity with unusual etiology Ann Thorac Med ... Written informed consent was obtained from the patient for publication of this case report and accompanying images A copy of the written consent is available for review by the Editor -in- Chief...
- 2
- 301
- 0
báo cáo khoa học: " New insight into the structures and formation of anthocyanic vacuolar inclusions in flower petals" potx
Ngày tải lên :
12/08/2014, 05:20
... deposits and strands was also apparent for the AVIs isolated from the adaxial epidermis of lisianthus inner petal and placed in water (Fig 3C) All these examinations of AVIs, both in live cells and as ... surfaces of the AVIs in adaxial epidermal cells appeared as a collection of irregular colored deposits and strands that were tangled in the central space of the vacuole (Fig 3A) The pink area surrounding ... surrounding the AVI appeared to have a higher anthocyanin concentration around membrane-like structures weaving through the area (Fig 3A) These pink areas became colorless in most cells as the petals...
- 14
- 260
- 0
Báo cáo y học: "The incidence of hip, forearm, humeral, ankle, and vertebral fragility fractures in Italy: results from a 3-year multicenter stud" pptx
Ngày tải lên :
12/08/2014, 15:22
... comparative analyses between the hospitalization rate computed for vertebral fractures in our survey and data from the National Hospitalization Database (SDO) To acquire all the necessary data ... each kind of fracture Population data concerning the examined years were obtained from the Italian Institute for Statistics (ISTAT) Data were processed by using Stata (StataCorp, College Station, ... physicians with a specific tool for the estimation of patients’ individual risk of fragility fractures (as the algorithm is mainly based on data obtained from Scandinavian and North American populations)...
- 9
- 311
- 0