conditional 1 put the verbs in brackets into the a correct form

verbs in brackets

verbs in brackets

Ngày tải lên : 14/09/2013, 02:10
... decision has been reached 99 The Chinese (make)………………………………… spaghetti dishes for a long time before Marco Polo (bring)………………………………… it back to Italy 10 11 12 13 14 15 16 17 18 19 20 10 0 If he had missed ... last months, I (have)………………………………… .a job as a tutor in a small school 10 I (read)…………………………… the passage carefully and then I (answer) ………………………………all the questions 11 when they(wait)………………………………some ... at our place, we (find) that a burglar (break) in 15 / Almost everybody (leave) _ for home by the time we (arrive) _ Exercise VII : Put the verbs in brackets in the past...
  • 13
  • 774
  • 3
A study of the linguistic features of suggestion verbs in english and their vietnamese equivalents

A study of the linguistic features of suggestion verbs in english and their vietnamese equivalents

Ngày tải lên : 26/11/2013, 13:17
... 5 4 34 Rate 14 .7% 11 .8% 14 .7% 11 .8% 11 .8% 8.7% 11 .8% 14 .7% 10 0% 25 26 Table 4.53 A Summary of the Meaning Nuances of SVs Private Meaning Common Meaning Nuances Nuances Group of Meaning Verbs Occurrence ... are analyzed basing on the theoretical background by Quirk et.al [33] such as the construction of the verbs, verb phrases The semantic characteristics are shown like the meaning nuances and the ... features and making a contrastive analysis to find out the similarities and differences between the syntactic features of ESVs and VSVs - Analyzing data of ESVs and VSVs in terms of the semantic features...
  • 13
  • 1.3K
  • 5
The primary verbs in english and the errors make by students

The primary verbs in english and the errors make by students

Ngày tải lên : 18/12/2013, 21:45
... or the past participles or infinitive to form ordinary verbs, they are not added to the meaning of the main verbs But when they stand alone, they are the meaningful verbs The auxiliary verbs affect ... of the study : 10 Auxiliary verbs in general, and the primary auxiliary verbs as well as the contrastive analysis of primary auxiliary in English and the equivalents in Vietnamese Methods of the ... of certainty or obligation A modal verb is always the first word in the verb phrase It always has the same form and never has an ending such as: Infinitive (to may); -ing participle (maying) or...
  • 52
  • 621
  • 2
Tài liệu Module 1: Introduction to XML in the .NET Framework doc

Tài liệu Module 1: Introduction to XML in the .NET Framework doc

Ngày tải lên : 24/01/2014, 09:20
... Module 1: Introduction to XML in the NET Framework Common Business Problems Integrating disparate applications Translating between data formats Searching for and querying data Manipulating data *****************************ILLEGAL ... by using templates that provide standardization Generating XML from data in another format Business data exists in many different formats, including EDIFACT, ANSI X12, XML, comma-separated value ... issues include the following: Transforming data from XML into another format You might need to transform data in one XML grammar into another if the elements and attributes of the application...
  • 22
  • 411
  • 0
Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

Ngày tải lên : 18/02/2014, 04:20
... [16 ] and invasion into reconstituted basement membrane [17 ,18 ] The MT1-MMP ICD is also critical for the intracellular trafficking of the enzyme [19 –23] and its targeting to invadopodia in invasive ... tag Full-length GRASP55, GRASP55 PDZ1 (amino acids 1 10 7), GRASP55 PDZ2 (amino acids 84 17 2) and GRASP55 region (amino acids 17 3–454) were fused to GAL4 DNA binding domain in the pBIND Checkmate ... MT1 MT1 C GAL4 + VP16 GAL4 GRASP55 + VP16 GAL4 + VP16 TGF-α GAL4 GRASP55 + VP16 TGF-α A GAL4 + VP16 MT1 GAL4 GRASP55 + VP16 MT1 GAL4 GRASP55 + VP16 MT1 FRR GAL4 GRASP55 + VP16 MT1 HGT GAL4 GRASP55...
  • 18
  • 603
  • 0
Tài liệu Báo cáo khoa học: A novel type of highly negatively charged lipooligosaccharide from Pseudomonas stutzeri OX1 possessing two 4,6-O-(1-carboxy)-ethylidene residues in the outer core region ppt

Tài liệu Báo cáo khoa học: A novel type of highly negatively charged lipooligosaccharide from Pseudomonas stutzeri OX1 possessing two 4,6-O-(1-carboxy)-ethylidene residues in the outer core region ppt

Ngày tải lên : 19/02/2014, 13:20
... at 30 °C, at pD 14 and (uncorrected values), respectively 1H- and 13 C-NMR experiments were carried out using a Varian Inova 500 or a Varian Inova 600 instrument, whereas for 31P-NMR spectra a ... and characterized [12 ,13 ], mainly from Pseudomonas aeruginosa strains [ 21, 37–43] The carbohydrate backbone of the so-called inner core region of Pseudomonas LPS determined so far has always been ... Brade, H (19 94) Isolation and structural analysis of oligosaccharide phosphates containing the complete carbohydrate chain of the lipopolysaccharide from Vibrio cholerae strain H 11 (non-O1) Eur...
  • 14
  • 715
  • 0
Tài liệu Báo cáo khoa học: "HOW DO WE COUNT? THE PROBLEM OF TAGGING PHRASAL VERBS IN PARTS" docx

Tài liệu Báo cáo khoa học: "HOW DO WE COUNT? THE PROBLEM OF TAGGING PHRASAL VERBS IN PARTS" docx

Ngày tải lên : 20/02/2014, 21:20
... words These sentences were first tagged manually to provide a baseline and then tagged automatically using PARTS The a priori option of assuming only a verbal tag for all the pairs in question was ... actually degrades performance because in some cases the content word is a. lmost always a noun rather than a verb For example, a phrasal verb like box in generally appears with an intervening ... examined in tile first column, PARTS performance for each pair in tile second, and the results of assuming a verbal tag in the third (The "choice" colunm is explained below.) The average performance...
  • 3
  • 516
  • 1
Tài liệu Báo cáo khoa học: Fra-1 targets the AP-1 site/2G single nucleotide polymorphism (ETS site) in the MMP-1 promoter docx

Tài liệu Báo cáo khoa học: Fra-1 targets the AP-1 site/2G single nucleotide polymorphism (ETS site) in the MMP-1 promoter docx

Ngày tải lên : 21/02/2014, 00:20
... decrease in the intensity and/or a complete disappearance of some bands, indicated by arrows In contrast, bands that are more intense in the lanes containing the 1G probe appear unchanged in the ... the stress-activated protein kinase/ c-Jun N-terminal kinase pathway and a sensitive p38 mitogenactivated protein kinase inhibitor cascade Arthritis Rheum 44, 73–84 43 Bhattacharya, A. , Lakka, ... promoter in the presence of increasing amounts of Fra1 may be due to the effects of Fra -1 on the proximal AP -1 site The greater increase in the induction of the 2G promoter may result from Fra -1 acting...
  • 10
  • 406
  • 0
Báo cáo khoa học: Insulin induces heme oxygenase-1 through the phosphatidylinositol 3-kinase/Akt pathway and the Nrf2 transcription factor in renal cells pptx

Báo cáo khoa học: Insulin induces heme oxygenase-1 through the phosphatidylinositol 3-kinase/Akt pathway and the Nrf2 transcription factor in renal cells pptx

Ngày tải lên : 07/03/2014, 12:20
... primers and probes specifically designed for human HO -1: forward primer 5¢-AGGGTGATAG AAGAGGCCAAGA, reverse primer 5¢-CAGCTCCTGCA ACTCCTCAA and TAMRA-labeled probe 6-FAM-TGC GTTCCTGCTCAACATCCAGCT-TAMRA ... (Akt-myr) contains an N-terminal myristoylation sequence targeting Akt to the plasma membrane The dominant-negative form (Akt-K179M) contains a methionine for lysine substitution at residue 17 9 ... construct (pHOGL3 ⁄ 11 .6) was a kind gift from A Agarwal (University of Alabama, Birmingham, AL, USA) The heat shock protein 70-bgalactosidase (HSP70-b-gal) reporter construct was a kind gift from...
  • 12
  • 377
  • 0
Mobil 1 is original equipment in some of the world’s finest vehicles, including potx

Mobil 1 is original equipment in some of the world’s finest vehicles, including potx

Ngày tải lên : 08/03/2014, 19:20
... that new engines need break -in periods using conventional motor oil? That is a myth In the past, engine break -in was necessary to remove any metal flashing or any other abrasive material left inside ... owner’s manual to check whether these standards are applicable to your vehicle More information about ACEA can be found at www.acea.be 26 Special Applications for Mobil 1 Can Mobil be used in passenger-vehicle ... in the landing gear, leading to bearing failure ExxonMobil devised a way of synthesizing grease that retained its lubricating characteristics over a wider range of temperatures than was possible...
  • 14
  • 517
  • 0
Báo cáo khoa học: Thermal behaviour of cubic phases rich in 1-monooleoyl-rac-glycerol in the ternary system docx

Báo cáo khoa học: Thermal behaviour of cubic phases rich in 1-monooleoyl-rac-glycerol in the ternary system docx

Ngày tải lên : 17/03/2014, 09:20
... gets thinner, with the minimal and the parallel surfaces of the polar/nonpolar interface approaching each other, again resulting in an increased wedge shape of the lipids Previously, Ai and Caffrey ... indicate the calculated positions obtained for the Pn3m structure based on the first peak in the diffractogram In samples D and E a rather drastic broadening in the line shape of the peaks indexed ... scanning calorimeter (DSC), and the temperature-scanning rate used was °CÆmin )1 during heating, while the cooling rate was approximately °CÆmin )1 To ensure that a powder pattern was obtained, the capillary...
  • 10
  • 406
  • 0
Verbs in the Written English of Chinese Learners: A Corpus-based Comparison between Non-native Speakers and Native Speakers potx

Verbs in the Written English of Chinese Learners: A Corpus-based Comparison between Non-native Speakers and Native Speakers potx

Ngày tải lên : 24/03/2014, 19:20
... starting point for further analysis Filtering the computer-retrieved data for meaningful information should be the core of CIA and it takes strategies to transform the raw computer data into a refined ... The earliest application of the corpus was in writing the Longman Language Activator which was published in 19 93 (Gillard and Gadsby 19 98: 16 0) The LLC played an important role in the compilation ... significant advance when EA researchers to have placed the learner language (rather than L1 and L2) under examination A central consensus among EA researchers was that the learner’s errors, instead of...
  • 345
  • 621
  • 0
Báo cáo khoa học: Stability of the major allergen Brazil nut 2S albumin (Ber e 1) to physiologically relevant in vitro gastrointestinal digestion doc

Báo cáo khoa học: Stability of the major allergen Brazil nut 2S albumin (Ber e 1) to physiologically relevant in vitro gastrointestinal digestion doc

Ngày tải lên : 30/03/2014, 15:20
... (phase 1) RP-HPLC-ESI-MS analysis of an intact 2S albumin peak (Fig 3B) showed the presence of four molecular masses (12 212 .1, 12 12 5.8, 11 980.0 and 11 504.0) corresponding to the intact 2S albumin, ... Uncertain origin Mass c Ragged C- and N-termini located in the large chain Therefore, a common IgE epitope has been described in the large chain of 2S albumins from yellow and oriental mustard Sin ... peptides in the Brazil nut 2S albumin (Ber e 1) (A) Potential cleavage sites of pepsin are indicated with arrows Major resistant peptides are shaded; peaks and are as described in Fig 3D Amino acids...
  • 12
  • 322
  • 0
Báo cáo Y học: Expression of the uncoupling protein 1 from the aP2 gene promoter stimulates mitochondrial biogenesis in unilocular adipocytes in vivo potx

Báo cáo Y học: Expression of the uncoupling protein 1 from the aP2 gene promoter stimulates mitochondrial biogenesis in unilocular adipocytes in vivo potx

Ngày tải lên : 31/03/2014, 15:20
... b-actin a Antisense primer (5¢)3¢) GenBank acc no AGAAGGCGCTGAAGGAGAAGGA ATGGGCCAATGTCCGCAGTGATGTC GAACCCTAAGGCCAACCGTGAAAAGAT CCAGCATGCCGAGGGAGTGA GGTGGCCTCTGATGCTTGCGTCGTCT ACCGCTCGTTGCCAATAGTGATG ... 2002 10 11 12 13 14 15 16 17 18 19 20 21 promoter reveal several putative transactivating factors including Ets1, retinoid X receptor, thyroid hormone receptor, and a CACCC Box-binding protein ... sections) and at the ultrastructural level In case of light microscopy the surface area of about 13 0 17 0 cells for each animal was measured by an Image Analyzer KS100 IBAS Kontron (Karl Zeiss Jena,...
  • 10
  • 555
  • 0
Báo cáo khoa học: "A CONSIDERATION ON THE CONCEPTS STRUCTURE AND LANGUAGE IN RELATION TO SELECTIONS OF TRANSLATION EQUIVALENTS OF VERBS IN MACHINE TRANSLATION SYSTEMS" doc

Báo cáo khoa học: "A CONSIDERATION ON THE CONCEPTS STRUCTURE AND LANGUAGE IN RELATION TO SELECTIONS OF TRANSLATION EQUIVALENTS OF VERBS IN MACHINE TRANSLATION SYSTEMS" doc

Ngày tải lên : 31/03/2014, 17:20
... equivalent ( D o , Play : ~ - & ) that can be associated in common to a part of the structure of the categories as in Fig.l, and then find appropriate translation equivalents in detail at the ... level categories (2) To each verb found in the process of the association, consults ordinary dictionary of translation equivalents and word usage of verbs and obtain the set of all the translation ... considerations of space size and realizability on actual data, because we have to check all the combinations of several ten thousands nouns with each verb (i) The only one natural conceptural categories...
  • 3
  • 394
  • 0
Báo cáo khoa học: "Determining the placement of German verbs in English–to–German SMT" ppt

Báo cáo khoa học: "Determining the placement of German verbs in English–to–German SMT" ppt

Ngày tải lên : 31/03/2014, 21:20
... subject any any any any any any clausefinal ∅ mainV ∅ mainV finV VC Table 1: Position of the German subjects and verbs in declarative clauses (decl), interrogative clauses and clauses with a peripheral ... incorrectly In our translation, all verbs are translated and placed correctly Another problem which was often observed in the baseline is the omission of the verbs in the German translations The baseline ... the training data and extracted with the correct German phrase (but the German order is again incorrect) 6.3 Collocations Collocations (verb–object pairs) are another case which can lead to a...
  • 10
  • 514
  • 0
Báo cáo Y học: NMR structure of the HIV-1 regulatory protein Vpr in H2O/trifluoroethanol Comparison with the Vpr N-terminal (1–51) and C-terminal (52–96) domains pot

Báo cáo Y học: NMR structure of the HIV-1 regulatory protein Vpr in H2O/trifluoroethanol Comparison with the Vpr N-terminal (1–51) and C-terminal (52–96) domains pot

Ngày tải lên : 31/03/2014, 23:20
... [8] may expose the N-terminal (1 39) portion of the protein and allow its tight binding to Lys-tRNA synthetase [15 ] The C-terminal domain (52–96)Vpr and not the N-terminal domain (1 51) Vpr, has ... for the 22 uniformly labeled amino acids introduced into Vpr In the case of the two leucine residues at positions 64 and 67, 15 N and 1H resonances were overlapped and the relaxation data for these ... Thr55 a1 Gly56 a1 Gly56 a2 Gly56 a2 Gly56 a Ala59 a Ala59 b Ala59 b Ala59 a1 Gly56 a1 Gly56 a2 Gly56 a2 Gly56 b Glu58 b Glu58 b1 Asp52 b2 Asp52 (Val57, Leu 61, Leu63, Leu64, Leu67, Leu68 and Ile74)...
  • 10
  • 475
  • 0
Báo cáo hóa học: " Dissecting the role of putative CD81 binding regions of E2 in mediating HCV entry: Putative CD81 binding region 1 is not involved in CD81 binding" pot

Báo cáo hóa học: " Dissecting the role of putative CD81 binding regions of E2 in mediating HCV entry: Putative CD81 binding region 1 is not involved in CD81 binding" pot

Ngày tải lên : 20/06/2014, 01:20
... D53 5A D53 3A W52 9A Y52 7A R49 2A Y48 9A H48 8A W48 7A Y48 5A R48 3A D48 1A Y47 4A EnvA VSVG HCV WT A ~70kDa E2 actin Y 618 A H 617 A W 616 A L 615 A R 614 A F55 0A Y 613 A W54 9A D53 5A D53 3A W52 9A Y52 7A R49 2A Y48 9A H48 8A ... CD 81 binding Whereas D53 5A, R 614 A and W 616 A all displayed a disrupted AR 3A epitope in this region, indicative of more global structural aberrances Y52 7A, W52 9A, Y 613 A, H 617 A and Y 618 A have intact ... and in CD 81 binding Specifically, mutants W52 9A, D53 5A, Y 613 A, R 614 A, W 616 A and H 617 A did not bind soluble CD 81 at all, and two mutants, Y52 7A and Y 618 A, exhibited dramatically reduced interaction...
  • 12
  • 351
  • 0

Xem thêm