china apos s ming dyansty a dream journey
Báo cáo khoa học: Molecular dynamics structures of peptide nucleic acidÆDNA hybrid in the wild-type and mutated alleles of Ki-ras proto-oncogene ppt
Ngày tải lên :
07/03/2014, 21:20
... (pc gamess) is used in the calculation of RESP charges (Figs S2 and S3 A D of the Supplementary material) It is noteworthy that the partial charges for the various atoms of bases are very similar ... O, Ishitani R, Yaremchuk A, Tukalo M, Cusack S, Sakamoto K & Yokoyama S (2003) Structural basis for orthogonal tRNA specificities of tyrosyl-tRNA synthetases for genetic code expansion Nat Struct ... chem.msu.su/gran/gamess/index.html) and RESP [60] module of amber 6, because the same is not available in the amber standard library Electrostatic potential calculated using the HF ⁄ 6–31G* basis set...
- 16
- 382
- 0
báo cáo khoa học: " An unedited 1.1 kb mitochondrial orfB gene transcript in the Wild Abortive Cytoplasmic Male Sterility (WA-CMS) system of Oryza sativa L. subsp. indica" ppt
Ngày tải lên :
12/08/2014, 03:21
... that suppress cytoplasmic dysfunction In almost all plant CMS systems studied to date, the male sterility trait was associated with changes in mitochondrial gene organization [4] demonstrated that ... probe atp9-5’ CGGCGGATCCATGTTAGAAGAAGGAGCTAAATA 63°C PCR primer for the atp9 gene probe atp9-3’ CGGCGAGCTCCTATTTGCAAAGAGAGATATC 63°C PCR primer for the atp9 gene probe atpA-5’ ATATCTGCAGCATGGAATTCTCACCCAGAGCTGG ... normal cytoplasm, APMS-6B; and a standard cytoplasm restorer line BR-1870 The lines were obtained from Acharya Ranga Agricultural University, Hyderabad, India APMS- 6A was derived from repeated backcrossing...
- 18
- 336
- 0
my life in the wild cheetah
Ngày tải lên :
27/10/2014, 14:11
... about half of a cheetah s chases are successful Cheetahs choose and stalk their prey Cheetahs move almost silently when they are hunting This allows them to get as close to their prey as they can ... we soon lose interest Copyrighted Material My brothers start to play fight Their noise alerts the animal our mother has chosen It takes off across the plains Mom speeds after it, then falls back, ... black spots and “tear stripes” on my face My home is the African grasslands I run as fast as the wind Let me tell you my story Copyrighted Material My brothers and I are born I cannot see my...
- 57
- 291
- 0
life in the wild b
Ngày tải lên :
06/11/2014, 21:58
... reptiles and amphibians 151 Reptiles anD amphibians By contrast, a reptile such as a lizard or snake has a waterproof, typically scaly skin This equips many reptiles to colonize arid habitats without ... prasina) One of eight species that live in southern and southeast Asia, it is a very slender snake that resembles a vine stem, and has short venomous fangs that it uses to subdue tree-dwelling lizards ... of advantages Its bill enables the toucan to reach fruits borne on parts of a tree that could not take its weight, and is used in threat displays against other fruit-eating birds As well as fruit,...
- 121
- 282
- 0
life in the wild a
Ngày tải lên :
06/11/2014, 22:00
... mammals 014 The eastern gray kangaroo (Macropus giganteus) lives in parts of Australia and Tasmania, in small social groups known as “mobs.” Typically, these include a leading male and several subordinate ... mammals 048 Some varieties of brown bear (Ursus arctos) are larger than others, and these Alaskan, or Kodiak, bears are the largest They are similar in size to polar bears, and can weigh as ... long-tailed macaque has a varied diet that includes crabs, fruit, leaves, and insects 027 mammals The distinctive nose of the male proboscis monkey (Nasalis larvatus) serves a dual purpose It attracts...
- 120
- 261
- 0
life in the wild c
Ngày tải lên :
06/11/2014, 22:03
... Indo-Pacific region, squarespot anthias are usually seen in large groups on steep seaward slopes A single male has a large harem of females but, like all anthias, it is hermaphroditic—if a dominant ... potential mates, but at a price—its bright markings also attract predators It is also known as the yellow masked angelfish because of the yellow bar across its face Its body has scales of blue ... The squarespot anthia (Pseudanthias pleurotaenia) is also known as the square-back, purpleblotch basslet, squareblock, square, or mirror anthias—the names reflecting its unique color variation...
- 125
- 220
- 0
my life in the wild penguin
Ngày tải lên :
11/01/2015, 10:51
... huddle together to stay warm Two or three adults stay behind to guard them against an attack by birds such as skuas or giant petrels Each penguin makes its own unique sound When parents return with ... lower my head and call a special song Another penguin calls back I bow, so she can see my beautiful orange neck feathers She bows back We touch beaks, then dance together Copyrighted Material Copyrighted ... Copyrighted Material The hungry leopard seal follows us But out of the water she s slow and clumsy—too slow to catch any of us! Copyrighted Material After four long winters and summers, my friends and...
- 57
- 255
- 0
Logos and Law in the Letter of James The Law of Nature the Law of Moses and the Law of Freedom Supplements to Novum Testamentum
Ngày tải lên :
13/10/2016, 11:43
... liturgie," 162-67 This source analysis is in any case less than persuasive Boismard 's literary understanding o f James as a collection o f disparate and merely artificially linked materials, while not ... the possibility that a pseudonymous author has assumed the guise o f J a m e s o f Jerusalem, a n d the that Jas address, fact 1:1 must in any case b e u n d e r s t o o d as a highly s y m b ... rejects the idea While citing Justin 's similar phrase as the "closest apparent parallel," and noting in addition AC 8.12.8, as well as pas sages from Procopius o f Gaza and Methodius (on the latter...
- 298
- 1.5K
- 0
Báo cáo khoa họcRe-engineering the discrimination between the oxidized coenzymes NAD+ and NADP+ in clostridial glutamate dehydrogenase and a thorough reappraisal of the coenzyme specificity of the wild-type enzyme docx
Ngày tải lên :
06/03/2014, 00:20
... Photophysics SX18.MV-R stopped-ow apparatus with a dead-time of 1.3 ms was used for presteadystate kinetic measurements A mm optical pathlength in a 20 lL cell was used for absorbance measurements at ... concentrations were kept at or above Km values derived by steady-state analysis A minimum of lm enzyme was used for the assays Experimental procedures NADP+ purication Enzymes and substrates Kinetic ... dehydrogenase with mM NADP+ and 40 mM L-glutamate (all concentrations after mixing) A burst phase was detected in all cases The almost horizontal trace seen in each case after 23 s corresponds to the slow,...
- 9
- 526
- 0
Chronicles of a Dallas Cowboys Fan: Growing Up With America''''s Team in the 1960''''s by John Eisenberg pptx
Ngày tải lên :
14/03/2014, 17:20
... also followed the Chaparrals, who had such players as Cincy Powell and Cliff Hagan, and played at SMU s Moody Coliseum, where a courtside bleacher seat cost two dollars SMU s basketball teams, ... before games, no long lines at the concession stands, no big crowds squashing you into your seat Dallas was still a frontier outpost as a pro sports town There was no major league baseball in ... grassy spot every week The late morning was cast in a slanting light, the anticipation in the air almost palpable The crowd was casually dressed and mostly male, wearing cotton shirts and slacks...
- 18
- 466
- 0
The Persian Gulf in the Coming DecadeTrends, Threats, and OpportunitiesDaniel L. Byman • John R. Wise pptx
Ngày tải lên :
29/03/2014, 15:20
... Iranian Airfields to Gulf Capitals Iran s Naval Assets Gross Military Measures for Iran, Iraq, and the Gulf States Gulf State Selected Military Purchases, 1991–2000 Naval Surface Assets ... Whether Iran or Iraq will possess advanced surfaceto-air missiles and antiship cruise missiles, is trained to use various sophisticated systems, and otherwise is able to acquire the capabilities needed ... and Iraq 37 Table 2.9 Naval Surface Assets in the Gulf Country Iran Iraq Bahrain Kuwait Oman Qatar UAE Saudi Arabia Frigates w/SSM Frigates Corvettes Missile Patrol w/o SSM (SSM) Craft Craft 2...
- 94
- 207
- 0
The Project Gutenberg EBook of Explanation of Terms Used in Entomology, by John. B. Smith potx
Ngày tải lên :
28/06/2014, 19:20
... which is the only one that has been satisfactorily worked out for all orders, and a series of figures is added to explain this system so far as seems necessary It has not been considered feasible ... expansions of tracheal tubes in heavy insects, capable of inflation and supposed to lessen specific gravity Air-tube : a respiratory siphon Ala -ae : a wing or wings Alar appendage : see alulet ... Pennsylvania, Michigan, Wisconsin, Minnesota, eastern N Dakota, n e S Dakota, and the Alleghanies from Pennsylvania to Georgia Alligate -us: fastened or suspended by a thread; like the chrysalis...
- 912
- 285
- 0
in the crosshairs famous assassinations and attempts from julius caesar to john lennon
Ngày tải lên :
03/07/2014, 16:10
... could have been done, was not done; and, thus, the attempt to summon a miracle In the Crosshairs looks at assassinations and assassination attempts Assassination has been used for many reasons over ... reason for an assassination attempt is stunningly mundane Ronald Reagan s (page 201) assassin wanted to impress an actress Rebecca Schaeffer s (page 221) assassin was in love with her Francisco ... ruler s robe, and stabbed him in the upper back This was the signal for the assassination to begin, and a free-for-all started immediately In seconds, Julius Caesar was dead Caesar s assassination...
- 288
- 304
- 0
Yield and value of the wild fishery of rice fields in Battambang Province, near the Tonle Sap Lake, Cambodia pdf
Ngày tải lên :
06/07/2014, 22:20
... and small traps around the edges of paddies, and using other gears such as gillnets, cast nets, small seines, traps and fyke nets in adjacent canals and ponds Some specialised gears for frogs and ... (MRCS, 1994) Associated habitats include small water bodies (ponds and canals), other wetland crops, such as lotus, and small patches of brush Cambodian s main sources of animal protein are inland ... (Channa striata), climbing perch (Anabas testudineus) and walking catfish (Clarias macrocephalus) Right: peacock eel (Macrognathus siamensis), climbing perch (Anabas testudineus) and silver catfish...
- 90
- 524
- 0
The fault in our stars john green
Ngày tải lên :
27/07/2014, 07:56
... going, Hazel?” asked Gus s dad He was tall—almost as tall as Gus—and skinny in a way that parentally aged people usually aren’t “Okay,” I said “How was Isaac s Support Group?” “It was incredible,” ... his head as if waiting for permission “Yes,” Augustus said “Yes!” The trophy smashed against the floor, the plastic basketball player s arm splintering off, still grasping its ball Isaac stomped ... of meaning that art gives us valuable? Or is the only value in passing the time as comfortably as possible? What should a story seek to emulate, Augustus? A ringing alarm? A call to arms? A morphine...
- 158
- 431
- 0
Báo cáo lâm nghiệp: "The root-plant ratio changes in the first growing periods of wild cherry (Prunus avium L.) plantations" pptx
Ngày tải lên :
07/08/2014, 03:22
... version) RESULTS AND DISCUSSION The relationship between root system and aboveground biomass is one of the basic parameters for seedlings and plants according to the Czech standard (Jurásek et al ... plants in total Samples of 46 plants were randomly extracted from all research plots on May 9, 2006 Samples were cleaned of soil and put into labelled plastic bags and they were taken into a laboratory ... Kostelec nad Černými lesy near Truba Research Station The plots are a part of forest compartment 20B9 Generative bare-root plants were used as a planting stock The plants were set out manually...
- 6
- 332
- 0
Báo cáo lâm nghiệp: "reproductive and morphometric characteristics of wild boar (Sus scrofa) in the Czech republic" pot
Ngày tải lên :
07/08/2014, 10:21
... parameters is very important in individuals up to year of life (Fig 1) Inasmuch as there was sufficient data available in these categories, this result can be regarded as authoritative (statistically ... and Nymburk areas (areas similar to the Kostelec area), there are slightly lower values in the Kostelec area, however the maximum values are nearly identical The Doupov area and Šumava have averages ... important for determining the appropriate management of a game population that is now a major issue in professional circles As the main management suggestion is stopped the increasing of population...
- 8
- 301
- 0
báo cáo khoa học: " Patterns of sequence polymorphism in the fleshless berry locus in cultivated and wild Vitis vinifera accessions" pdf
Ngày tải lên :
11/08/2014, 11:21
... Genome Research Facility (AGRF) carried out Simple Sequence Repeats (SSR) and Single Nucleotide Polymorphism (SNP) analysis SNP were scored using the MassARRAY® iPLEX Gold assay with MALDI-TOF MS detection ... of Research We thank Isabelle Le Clainche, Audrey Weber, Sylvain Santoni, Christophe Lepage and all the team of the Vassal germplasm collection for technical assistance; Stéphane Nicolas, Aurélie ... (Sequenom) and SSR analysis was performed as previously described by Thomas et al [28] Quantitative PCR assay Two primer pairs were designed to amplify genomic DNA The first pair (TCTGATGCGATGTTAGTGGT...
- 15
- 421
- 0
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2