central 1 3 is the stuffer fragment segments of the lambda dna are removed and a stuffer fragment is put in this keeps the vector at a correct size

Tài liệu Lab 5.1.3 Using the Boot System Command pptx

Tài liệu Lab 5.1.3 Using the Boot System Command pptx

Ngày tải lên : 18/01/2014, 04:20
... This interface chart does not include any other type of interface even though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the ... There is no way to effectively list all of the combinations of configurations for each router class What is provided are the identifiers for the possible combinations of interfaces in the device This ... Serial (S1) 17 00 FastEthernet (FA0) FastEthernet (FA1) Serial (S0) Serial (S1) 2500 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 2600 FastEthernet 0/0 FastEthernet 0 /1 (FA0 /1) Serial 0/0...
  • 5
  • 395
  • 0
Tài liệu Lab 5.1.3 Using the Boot System Command doc

Tài liệu Lab 5.1.3 Using the Boot System Command doc

Ngày tải lên : 18/01/2014, 04:20
... This interface chart does not include any other type of interface even though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the ... There is no way to effectively list all of the combinations of configurations for each router class What is provided are the identifiers for the possible combinations of interfaces in the device This ... information in the table b Enter show running-config at the router prompt The router will display information on the running configuration file stored in RAM c Is the configuration that was just...
  • 5
  • 351
  • 0
Báo cáo y học: "The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes" ppt

Báo cáo y học: "The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes" ppt

Ngày tải lên : 09/08/2014, 08:22
... 579 [M10277] 54 10 0 [U 133 69] R: 5'-ACCCAAAACACAACTCTTCGG -3' R: 5'-GGTTTACATGTATTCTATGACAG -3' IL-1F8 F: 5'-ACCAAGGAGAGAGGCATAACTAAT -3' R: 5'-AGTGAACTCAGTCGCATAATGATC -3' IL -1 F: 5'-GCTGAGGAAGATGCTGGTTC -3' ... 5'-GCTGAGGAAGATGCTGGTTC -3' R: 5'-GTGATCGTACAGGTGCATCG -3' β-actin F: 5'-CCAAGGCCAACCGCGAGAAGATGAC -3' 28S F: 5'-TTGAAAATCCGCGGGAGA -3' R: 5'-AGGGTACATGGTGGTGCCGCCAGAC -3' R: 5'-ACATTGTTCCAACATGCCAG -3' Shown are the ... SB, PAG, MJHN and CG participated in the design of the study, data analysis, and drafting and reviewing of the manuscript All authors read and approved the final manuscript 16 17 18 19 Acknowledgements...
  • 11
  • 325
  • 0
Báo cáo y học: "Peroxisome proliferator-activated receptor γ1 expression is diminished in human osteoarthritic cartilage and is downregulated by interleukin-1β in articular chondrocytes" doc

Báo cáo y học: "Peroxisome proliferator-activated receptor γ1 expression is diminished in human osteoarthritic cartilage and is downregulated by interleukin-1β in articular chondrocytes" doc

Ngày tải lên : 09/08/2014, 10:20
... may, at least in part, be involved in increased expression of inflammatory and catabolic genes, promoting articular inflammation and cartilage degradation In addition, the observation that IL -1 and ... 5'-GCGATTCCTTCACTGATAC -3' ; common PPAR 1 and PPARγ2 antisense, 5'-CTTCCATTACGGAGAGATCC -3' ; glyceraldehyde -3- phosphate dehydrogenase (GAPDH) sense, 5'CAGAACATCATCCCTGCCTCT -3' ; and GAPDH antisense, ... functions of PPARγ in cartilage Indeed, we and others have previously reported that PPARγ activators inhibit several inflammatory and catabolic events involved in the pathogenesis of OA [4 ,11 ,12 ,32 -34 ]...
  • 11
  • 558
  • 0
The Project Gutenberg EBook of The Car of Destiny by C. N. Williamson and A. M. Williamson pot

The Project Gutenberg EBook of The Car of Destiny by C. N. Williamson and A. M. Williamson pot

Ngày tải lên : 07/03/2014, 11:20
... 15 25 29 35 41 51 57 65 75 81 85 97 10 7 11 7 12 9 13 9 14 5 14 9 15 7 16 9 18 5 19 9 215 2 23 235 245 2 51 x The Hand Under the Curtains Behind an Iron Grating On the Road to Cadiz The Seven ... That's what I'm afraid of, and that she has some plan about which she doesn't mean to talk till the last minute But she hasn't said anything lately about visiting the Duchess of Carmona in Spain, ... Gloria I stood at a distance, behind the King of England's car, and watched what he would M Levavasseur, the proprietor of the garage, came in just then, and I inquired in a low voice who the...
  • 424
  • 1.3K
  • 0
The impact of fodder trees on milk production and income among smallholder dairy farmers in East Africa and the role of research ppt

The impact of fodder trees on milk production and income among smallholder dairy farmers in East Africa and the role of research ppt

Ngày tải lên : 24/03/2014, 04:20
... specification); (c) a combination of a binary variable and actual amount; and (d) a combination of a binary variable, the actual amount and a squared term Qualitatively, the results from (a) and ... extension agents and farmers themselves have not been included in the calculation 13 Dissemination and adoption of fodder shrubs in East Africa 4 .1 Dissemination pathways, approaches and research As ... organizations during 20 03 2005 averaged 71 236 per farmer, depending on the country ( 236 in Uganda, 18 0 in Rwanda, 16 5 in Kenya and 71 in Tanzania) There was considerable variation among farms and across...
  • 55
  • 546
  • 0
báo cáo hóa học:" LCP external fixation - External application of an internal fixator: two cases and a review of the literature" pot

báo cáo hóa học:" LCP external fixation - External application of an internal fixator: two cases and a review of the literature" pot

Ngày tải lên : 20/06/2014, 04:20
... traditional frames are often bulky and ambulating with a lower limb fixator frame in- situ is awkward Some patients are self-conscious of these fixators and find them less aesthetically acceptable, ... [1- 5] comparable with rates of nonunion (up to 20%) [ 13 ] in traditional external fixation Nonunion in Case can be attributed to the nature of LCP application and characteristics of the LCP that ... suspended above bone During plate application, both plate and bone fragment can move independently, making accurate screw placement difficult as small shifts at the plate translate to great deviations...
  • 6
  • 477
  • 0
Báo cáo lâm nghiệp: " Optimising the management of uneven-aged Pinus sylvestris L. and Pinus nigra Arn. mixed stands in Catalonia, north-east Spain" pps

Báo cáo lâm nghiệp: " Optimising the management of uneven-aged Pinus sylvestris L. and Pinus nigra Arn. mixed stands in Catalonia, north-east Spain" pps

Ngày tải lên : 08/08/2014, 00:21
... Ns 6 81 595 540 436 606 439 438 416 626 6 13 537 4 21 Nn 22 28 66 19 63 98 43 70 45 58 11 3 bs 10 .00 10 .67 10 .00 10 .00 13 .59 12 .95 13 . 21 12.96 13 .48 13 .38 12 .94 11 .24 bn 10 .00 10 .00 15 . 23 10 .00 10 .00 ... stand was dominated by P sylvestris 752 A Trasobares, T Pukkala Table III Optimal combination of DVs, land expectation value (LEV, euro ha 1) , mean annual harvest (WP, m3 ha 1 a 1) and stand volume ... 84.4 81. 7 55 .3 11 7.2 86 .1 75.4 69 .3 11 8.8 11 1.5 99.2 76.6 a N: number of trees per hectare; b and c: parameters b and c of Weibull distribution; V and V : stand volumes (m3 ha 1) at beginning and...
  • 12
  • 412
  • 0
báo cáo khoa học: "Vulval elephantiasis as a result of tubercular lymphadenitis: two case reports and a review of the literature" pptx

báo cáo khoa học: "Vulval elephantiasis as a result of tubercular lymphadenitis: two case reports and a review of the literature" pptx

Ngày tải lên : 11/08/2014, 02:22
... seroma formation under the skin flaps that was managed by aspiration and pressure bandaging She also experienced episodes of serous discharge from the site that was self limiting and was managed ... Szuba A, Rockson SG: Lymphedema: anatomy, physiology and pathogenesis Vasc Med 19 97, 2 :3 21- 32 6 10 Szuba A, Rockson SG: Lymphedema: classification, diagnosis and therapy Vasc Med 19 98, 3 :14 5 -15 6 11 ... culminating in a local inflammatory response This results in a deposition of the connective tissue and adipose elements at the skin and subcutaneous level, leading to non-pitting edema In the...
  • 5
  • 457
  • 0
Báo cáo y học: " Unusual presentation of eosinophilic fasciitis: two case reports and a review of the literature" pdf

Báo cáo y học: " Unusual presentation of eosinophilic fasciitis: two case reports and a review of the literature" pdf

Ngày tải lên : 11/08/2014, 14:21
... inflammatory cells in muscle and fat tissues of (A) patient and (B) patient Hematoxylin and eosin stain, magnification ×200 Danis et al Journal of Medical Case Reports 2 010 , 4:46 http://www.jmedicalcasereports.com/content/4 /1/ 46 ... of cases Other treatments include NSAIDs, D-penicillamine, chloroquine, cimetidine, methotrexate, azathioprine, cyclosporin A, infliximab, UVA -1, and bath PUVA [10 ,11 ] Spontaneous remission rate ... FC: Rheumatoid arthritis with eosinophilic fasciitis and pure red cell aplasia J Rheumatol 19 89, 16 (10 ) : 13 83 - 13 84 15 Baumann F, Brühlmann P, Andreisek G, Michel BA, Marincek B, Weishaupt D: MRI...
  • 4
  • 323
  • 0
Báo cáo y học: " Comparative and functional genomics reveals genetic diversity and determinants of host specificity among reference strains and a large collection of Chinese isolates of the" ppt

Báo cáo y học: " Comparative and functional genomics reveals genetic diversity and determinants of host specificity among reference strains and a large collection of Chinese isolates of the" ppt

Ngày tải lên : 14/08/2014, 08:20
... encoded in 528T and that the expression and regulation of avrBs1 and XCC 210 0 in 8004 and 528T (ATCC 33 9 13 ) is different The postulated avr gene avrRc2 exists in the strains ATCC 33 9 13 , CN14, CN15 and ... (AY2880 83 .1) , X vesicatoria (Xv) strain CNPH345 (AY288080 .1) , Xv XV 111 1 (AF1 230 88.2), and other strains, such as Xcc 8004, Xcc ATCC 33 9 13 , Xac 30 6, Xcv 85 -10 , Xoo KACC1 03 31 , and Xoo MAFF 31 1 018 with the ... these, 57 are situated in eight XVRs while one is alone; 42 located mainly in XVR 13 .1, XVR17 and XVR18 are also absent from the British strain ATCC 33 9 13 [ 21] Whether the remaining 16 ADH CDSs in XVR02,...
  • 26
  • 322
  • 0
Exact modeling of multiple access interference, ber derivation and a method to improve the performance of UWB communication systems

Exact modeling of multiple access interference, ber derivation and a method to improve the performance of UWB communication systems

Ngày tải lên : 05/10/2015, 22:04
... chosen and the other is the truncation error involved in evaluating the infinite integrals in (3. 32), (3. 33) , (3. 34), (3. 41) and (3. 44) More number of samples is needed and the truncation window ... For TH-PAM 15 18 18 21 23 24 25 26 27 ii 3. 2.5 .3 For DS-PAM 3. 3 Derivation of CF and BER in AWGN channels CHAPTER CHAPTER 28 29 3. 3 .1 TH- PPM 29 3. 3.2 TH-PAM 32 3. 3 .3 DS-PAM 33 3. 4 Numerical results ... FADING CHANNELS In this chapter the performance of a correlator receiver in fading channel is derived In addition, an accurate method to numerically evaluate the CF of a lognormal random variable...
  • 104
  • 421
  • 0
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx

Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx

Ngày tải lên : 07/03/2014, 02:20
... gtccccagGCCGGATCA 64 AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG 17 2 CAACAAAGgtacatgc 13 35 ctgtgcagGTACTGGTG 10 28 utilized for the primer extension reaction, and indicated several possible transcription start ... is absent in the SAF -1 and SAF-2 isoforms Ray A & Ray BK (19 98) Isolation and functional characterization of cDNA of serum amyloid A- activating factor that binds to the serum amyloid A promoter ... transcribed and translated protein product from SAF -3 cDNA was of A B A Ray et al similar size to that obtained using the bacterial expression system, indicating that the major translation product of SAF-3...
  • 11
  • 439
  • 0
Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot

Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot

Ngày tải lên : 23/03/2014, 13:20
... Proton (1H) Chemical shift (p.p.m.) GalNAc:H1 GalNAc:CH3 GalNAc:H3 GalNAc:H1 Gal:H2 Gal:H2 4.79 1. 79 3. 77 4.79 3. 53 3. 53 10 ThrcCH3 12 AlaaH 10 ThrcCH3 10 ThrbH 11 AlaßCH3 12 AlaaH 0.98 4.07 0.98 4.04 1. 09 ... GalNAc:CH3 GalNAc:CH3 4.79 3. 77 3. 77 4.82 4.82 3. 53 1. 79 1. 79 1. 79 GalNAc:H2 GalNAc:H2 Gal:H1 Gal:H2 Gal:H3 Gal:H4 Gal:H2 Gal:H3 Gal:H4 3. 95 3. 95 4.82 3. 53 3. 43 3.72 3. 53 3. 43 3.72 Proton (1H) Chemical ... heteronuclear two-dimensional NMR spectroscopy The data clearly indicated that the tx 5a glycan is in an a- D-Gal- (1 3) -a- D-GalNAc configuration Taken together, these data demonstrate that two Conus glycopeptides...
  • 11
  • 563
  • 0
Báo cáo hóa học: " The synergistic effect of IFN-α and IFN-γ against HSV-2 replication in Vero cells is not interfered by the plant antiviral 1-cinnamoyl-3, 11-dihydroxymeliacarpin" pptx

Báo cáo hóa học: " The synergistic effect of IFN-α and IFN-γ against HSV-2 replication in Vero cells is not interfered by the plant antiviral 1-cinnamoyl-3, 11-dihydroxymeliacarpin" pptx

Ngày tải lên : 20/06/2014, 01:20
... combinations of interferon-alpha and -gamma J Infect Dis 19 92, 16 6 :14 01- 3 Barquero AA, Alché LE, Coto CE: Block of vesicular stomatitis virus endocytic and exocytic pathways by 1- cinnamoyl -3 ,11 dihydroxymeliacarpin, ... 2 93: 295 -30 4 Halford WP, Halford KJ, Pierce AT: Mathematical analysis demonstrates that interferons-beta and -gamma interact in a multiplicative manner to disrupt herpes simplex virus replication J Theor ... cells was determined by interpolation in a standard calibration curve correlating optical density values and number of viable cells determined by counting with a haemocytometer Statistics Data are...
  • 10
  • 544
  • 0
Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt

Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt

Ngày tải lên : 20/06/2014, 23:20
... relative to the native strain, during the second half of the logarithmic phase (Figure 5) The batch experiment has revealed that 1, 3- PD, acetate and ethanol are growth-associated in both the native ... yield of 1, 3- PD (up by 13 %) observed in the clone (Table 3) Interestingly, the specific rates of formation of lactate and ethanol were higher and that of acetate lower in the recombinant culture, ... pHR2 TA vector with yqhD pSIP 411 with yqhD This study This study Materials and methods Strains and plasmids The bacterial strains and plasmids used and modified in this study are listed in Table...
  • 8
  • 399
  • 0
Tiet 1-3 NC - KHÁI QUÁT VĂN HỌC VIỆT NAM TỪ CÁCH MẠNG THÁNG TÁM 1945 ĐẾN HẾT THẾ KỶ XX

Tiet 1-3 NC - KHÁI QUÁT VĂN HỌC VIỆT NAM TỪ CÁCH MẠNG THÁNG TÁM 1945 ĐẾN HẾT THẾ KỶ XX

Ngày tải lên : 13/09/2013, 20:10
... Sẽ ánh l a hồng bếp Một làng xa đêm gió rét… Ngh a màu đỏ theo Như chia ly… 9/ 19 64 NGƯỜI CON GÁI VIỆT NAM (Tap Gió lộng) (Tặng chị Lý anh dũng) Em ? Cô gái hay nàng tiên Em có tuổi hay tuổi Mái ... trúc (19 78), Nguyễn Trãi Đông GV Kha Chí Công - Sân khấu: khai thác đề tài chiến tranh, lịch sử, xã hội Trang Trường THPT U Minh Thượng Giáo án Ngữ văn 12 - NC quan (19 79) + Xã hội: Lưu Quang Vũ ... đứng cao GV Kha Chí Công Giáo án Ngữ văn 12 - NC thống Lịch sử sang trang mới: đất nước độc lập, thống nhất, h a bình, xây dựng CNXH - Đất nước gặp khó khăn mới: Hai chiến tranh biên giới Tây Nam...
  • 10
  • 6.9K
  • 34
tuần 1-3.Sinh hoạt tập thể

tuần 1-3.Sinh hoạt tập thể

Ngày tải lên : 16/09/2013, 17:10
... ………………………………………………………………………………………… TỔ TRƯỞNG BAN GIÁM HIỆU TUẦN SINH HOẠT LỚP Tiết 12 Trang GV: KIẾN VĂN LINH 3A Ngày 18 /5/2 010 I/MỤC TIÊU: -Tham gia phong trào giữ gìn trường lớp đẹp -Xây dựng ... xét đ a đến kết luận chung tình hình lớp -Tuyên dương học sinh học tập tốt,nhắc nhở học sinh có tượng sai phạm 2.PHƯƠNG HƯỚNG: a. Các khoảng đóng góp: -Học sinh lắng nghe -Sinh hoạt học sinh đóng ... Trang GV: KIẾN VĂN LINH 3A Tiết 12 Ngày 18 /5/2 010 I/MỤC TIÊU: -Phổ biến khoảng đóng góp -Tiếp tục ổn đònh lớp -Xây dựng nề nếp vào lớp IINỘI DUNG: HOẠT ĐỘNG THẦY HOẠT ĐỘNG TRÒ 1. SƠ KẾT *Yêu cầu...
  • 6
  • 488
  • 0
Period: 41- Lesson C.ON THE MOVE(1-3)

Period: 41- Lesson C.ON THE MOVE(1-3)

Ngày tải lên : 24/10/2013, 05:11
... a5 .Is there……….flower garden near your house? • a. a b.an c .the a - Learn by heart model sentences and vocabulary - Practice with a partner: Ask and answer about means of transportation -Do the ... Tuan Hoa I go to school by bus I go to school by car Huong I walk to school Match mean of transportation with the correct words motorbike car train bus bike plane (to) walk Unit 7: Lesson 5: C1 -3/ ... motorbike C3*Listen and write short answers in your exercise book Eg: - How they travel? - By bus a) Ba By motorbike e) Tuan By bus b) Lan By plane f) Mrs.Huong By car c) Nam By bus g) Mr Ha d) Nga By...
  • 20
  • 401
  • 1
LUYỆN ĐỌC TIẾNG ANH QUA TÁC PHẨM VĂN HỌC-THE ADVENTURES OF SHERLOCK HOMES -ARTHUR CONAN DOYLE 1-3

LUYỆN ĐỌC TIẾNG ANH QUA TÁC PHẨM VĂN HỌC-THE ADVENTURES OF SHERLOCK HOMES -ARTHUR CONAN DOYLE 1-3

Ngày tải lên : 08/11/2013, 02:15
... hand which the King had stretched out to him, he set off in my company for his chambers And that was how a great scandal threatened to affect the kingdom of Bohemia, and how the best plans of ... Majesty say so." "I am immensely indebted to you Pray tell me in what way I can reward you This ring " He slipped an emerald snake ring from his finger and held it out upon the palm of his hand ... return." "And the papers?" asked the King hoarsely "All is lost." "We shall see." He pushed past the servant and rushed into the drawingroom, followed by the King and myself The furniture was scattered...
  • 6
  • 270
  • 0