c reactive protein function
Tài liệu Giáo trình C- REACTIVE PROTEIN docx
Ngày tải lên :
27/01/2014, 13:20
... atorvastatin- mà chưa đạt tớim c tiêu
LDL -C hay CRP- nhiều c ch chữa trị kh c đã đư c chứng minh là giảm đư c LDL -C hay CRP
riêng rẽ. Một là thu c ezetimibe, một chất ngăn chận sự hấp thụ cholesterol. ... m c độ chất béo, bằng c ch làm tăng cholesterol tốt (HDL -C) và làm giảm
triglyceride c ng giúp giữ m c độ CRP thấp.
M C TIÊU CRP
Hiện nay c n quá sớm để x c định một phương sách c n c ... PHƯƠNG SÁCH ĐỂ LÀM GIẢM CRP
Những nghiên c u trên cho thấy rằng gia tăng liều statins sẽ làm giảm m c độ cuả LDL -C và
CRP. Vì vậy dùng statins một c ch tích c c là một c ch để giảm thiểu CRP....
- 4
- 382
- 0
C-Reactive Protein in Patients with Pulmonary Tuberculosis ppt
Ngày tải lên :
15/03/2014, 03:20
... was calculated for age
concentration as a prognostic marker of chronic and CRP. The stratification was done for age, gender,
inflammation in patients with cardiovascular disease, C- reactive protein ... 2009. Serum
C- reactive protein in patients with pulmonary C- Reactive Protein in Pulmonary Tuberculosis:
tuberculosis and malignant tumors of the chest. Correlation With Bacteriological Load and ... disappearance of C- reactive CRP concentration over normal level reflect the extent of
protein is concomitant with effectiveness of drugs used the tissue injury and may predict the course of ensuing
in...
- 5
- 436
- 0
Role of C-Reactive Protein and Procalcitonin in Differentiation of Tuberculosis from Bacterial Community Acquired Pneumonia potx
Ngày tải lên :
22/03/2014, 18:20
... concentrations (
r=0.648, p=0.01).
Diagnostic accuracy for discriminating TB from
bacterial CAP
In the ROC curve analysis, the CRP concentration had a
Kang YA, et al. C- reactive protein and procalcitonin ... Jaccard C, Corradin SB, et al. Cytokines, nitrite/
nitrate, soluble tumor necrosis factor receptors, and procalcitonin
concentrations: comparisons in patients with septic shock,
cardiogenic shock, ... tuberculosis and bacterial
community-acquired pneumonia for C- reactive protein (CRP)
and procalcitonin (PCT). No difference was detected in the
discriminative value between CRP and PCT.
...
- 6
- 515
- 2
Tài liệu Giáo trình CRP (Protein C Reactive) pptx
Ngày tải lên :
17/12/2013, 08:15
... pháp đo độ đ c (nephelometry).
Bình thường CRP huyết thanh < 10 mg/l.
CRP ( protein C reactive )
M C TIÊU:
- Hiểu đư c nguồn g c và bản chất c a CRP
- Biết đư c ch c năng miễn dịch và ý nghĩa ...
sinh.
- C y máu (+) là tiêu chuẩn vàng cho chẩn đoán NTH, nhưng trong một số điều kiện
th c tế không phải l c nào c ng sẵn c và cho kết quả đáng tin c y.
- CRP (C- reactive protein) là một chất ... hữu ích trong vi c theo dõi và c thể góp phần trong vi c giảm thiểu
những trường hợp dùng kháng sinh không c n thiết.
- Ngoài CRP, c c cytokine và PCT c ng c thể hữu ích trong vi c chẩn đoán...
- 9
- 619
- 6
Báo cáo khoa học: Allosteric functioning of dimeric class C G-protein-coupled receptors doc
Ngày tải lên :
07/03/2014, 21:20
... several
consequences of this in terms of speci c functional properties and drug
development.
Abbreviations
Acc, active-closed-closed conformation; Aco, active-closed-open conformation; CaS, receptor, ... receptor activation [39].
Allosteric functioning of the HD
of class C GPCRs
As observed for class A GPCRs, some class C recep-
tors display constitutive, agonist-independent activity.
As described ... asymmetric active-closed-
open (Aco) and the symmetric active-closed-closed
(Acc) conformations.
How can agonist binding affect the relative orienta-
tion of the VFTs? Much can be deduced from...
- 9
- 315
- 0
Vai trò của C-reative protein trong chẩn đoán viêm ruột thừa cấp
Ngày tải lên :
15/11/2012, 10:43
... (VRT) c p là c p c u Ngoại khoa thường gặp, tỉ lệ
chẩn đoán sai c n cao. C- reactive protein (CRP) đư c ứng dụng nhiều. Ở Việt
Nam, chưa c nghiên c u nào về CRP trong VRT.
M c tiêu: X c định ...
Keywords: appendicitis, C- reactive protein, laparoscopy.
ĐẶT VẤN ĐỀ
VRT c p là c p c u Ngoại khoa thường gặp. Tỉ lệ chẩn đoán sai c n cao.
CRP đư c ứng dụng nhiều trong chẩn đoán c c bệnh nhiễm ... chưa BC và c BC (p lần lượt là 1,000 và 0,675).
C- reactive protein máu
Giá trị c a CRP trong chẩn đoán VRT c p
Bảng 4: Kết quả phân tích hồi quy Logistic chẩn đoán VRT c p theo nồng độ
CRP...
- 22
- 1K
- 4
Báo cáo khoa học: Calcite-specific coupling protein in barnacle underwater cement docx
Ngày tải lên :
07/03/2014, 05:20
... 5¢-AATGTA
CCATGGAAGCGCCGT-3¢ and 5¢-GCCTTCTGTTCGG
ATCCCAAGGCT-3¢. The polyclonal antibody was raised
in rabbits by serial subcutaneous injection (Takara Bio).
Immunochemical detection was carried ... N-terminal and C- terminal regions of mature Mrcp-20k
to create the NcoI and BamHI restriction sites, respectively:
5¢-AGTTG
CCATGGCGCACGAGGAGGA-3¢ and 5¢-TT
CTGTTC
GGATCCCAAGGCTTA-3¢. The amplified ... been collected from the surface of the barnacle
calcareous base, some contamination of the proteins
used for calcification may have occurred. However, the
fact that Mrcp-20k could not be detected...
- 11
- 471
- 0
C++ Lab 8 Functions pptx
Ngày tải lên :
08/03/2014, 00:20
... this example) is sent to the called function (function- celsius). This
variable exists in that function only during the execution of that function. If that function
is called again, the old value ... verse1, chorus, verse2, chorus, and so
on. Look at the main: it is not cluttered. In the main, the functions were called. The
function chorus was called four times; all other functions were called ... modules, functions and classes. In this
chapter we will deal with functions. You can write functions that can be used over and
over again in a program or in several programs. In fact, the C+ + standard...
- 10
- 228
- 0
Báo cáo khoa học: Plant oxylipins: Plant responses to 12-oxo-phytodienoic acid are governed by its specific structural and functional properties ppt
Ngày tải lên :
16/03/2014, 02:20
... non-radical reactive oxygen species accounts
Fig. 2. Schematic representation of stress-induced processes med-
iated by reactive electrophilic species, such as phytoprostanes and
OPDA, and jasmonic ... feed-
back loop, inducing the expression of detoxification
enzymes such as GSTs and lipid transfer proteins.
OPDA can be released from
cyclo-oxylipin-galactolipids
Cyclic oxylipins do not occur exclusively ... epoxy functions can behave
like reactive electrophilic species (RES) towards cellu-
lar nucleophiles [57]. In this regard, a,b-unsaturated
keto groups can participate in nucleophilic Michael
additions...
- 12
- 416
- 0
Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx
Ngày tải lên :
16/03/2014, 13:20
... membrane-associated caveolae that lack cell surface
access can be identified by electron microscopy. We now report the identifi-
cation, after density gradient ultracentrifugation, of a subclass of ... apparently closed caveolae that were not labelled by cell sur-
face protein labelling of intact cells. These caveolae contained caveolin-1
and caveolin-2. Another class of high-density caveolae contained
caveolin-1, ... compared to the concentration
of caveolin, indicates a speci c function in cholesterol
metabolism. Such a notion is supported by the abun-
dance in this caveolae subclass of SR-BI, which medi-
ates...
- 12
- 460
- 0
Object oriented programming with C++ - Session 3 Function Overloading and References ppt
Ngày tải lên :
23/03/2014, 04:21
...
placed in
function
Code
placed
inline
Object Oriented
Programming with C+ +/
Session 3/ 13 of 35
Friend Functions (Contd.)
class Teacher{
private:
int th_data;
public:
void getteachdata();
friend ... //can access alpha
{int x = d.data;}
};
All the member functions of class beta can
access the private data members of alpha.
However, the public member functions of the
class alpha cannot ... advantage: Function can access the actual
variable in the calling program.
Also provides a mechanism for returning more
than one value from the function back to the
calling program.
Object Oriented...
- 35
- 688
- 0
Báo cáo khoa học: A1–Protein Function and Ageing pptx
Ngày tải lên :
23/03/2014, 15:20
... physicochemical properties of
amino acids (Biro JC et al. A common periodic table of codons
and amino acids. BBRC 2003; 306: 408–415) and the nature of
speci c nucleic acid protein interactions ... des Macromole
´
cules, Institut de Biologie
Structurale (CEA/CNRS/UJF), Grenoble, France.
E-mail: diguilmi@ibs.fr
The choline binding proteins (CBPs) are pneumococcal speci c
surface-exposed proteins, ... non-covalently bound to choline resi-
dues located on teichoic and lipoteichoic acids. We report here
the crystallographic structure of the phosphorylcholine esterase
(Pce) catalytic domain, of CBPE,...
- 72
- 425
- 0
Báo cáo khoa học: Helicobacter pylori single-stranded DNA binding protein – functional characterization and modulation of H. pylori DnaB helicase activity pptx
Ngày tải lên :
30/03/2014, 02:20
... (without stop codon), 5¢-CG
AGCTC AAA GGG GAT TTC TTC TTC-3¢; mCherry
forward SacI, 5¢-CGAGCTC ATG GTG AGC AAG GGC
GAG-3¢; mCherry reverse XhoI, 5¢-CCGCTCGAG TTA
CTT GTA CAG CTC GTC C- 3¢].
A. Sharma ... 5¢-CG GGATCCATGTTTAATAAAGTGA
TTATGG-3¢; HpSSB full length reverse BamHI,5¢CG GG
ATCCCTTCATCAATATTGATTTCAGG-3¢; HpSSBDC20
reverse BamHI, 5¢-CGGGATCCTCACTGTGCTTGTAA
ATTCTC-3¢; SSB reverse SacI ... DNA-binding proteins. Nucleic Acids
Res 30, 2809–2816.
23 Cadman CJ & McGlynn P (2004) PriA helicase and
SSB interact physically and functionally. Nucleic Acids
Res 32, 6378–6387.
24 Curth U, Genschel...
- 13
- 438
- 0
Báo cáo khoa học: Synechocystis DrgA protein functioning as nitroreductase and ferric reductase is capable of catalyzing the Fenton reaction potx
Ngày tải lên :
30/03/2014, 09:20
... 5’-ac
g aat tcc acc acc acc acc acc aca tgg
aca cct ttg acg cta tt-3’ and the reverse primer, 5’-tag
ctc gag
tta ggc aaa gga gtt ttc cca-3’. The forward primer was
designed to introduce six His ... environmental
stresses such as iron depletion.
Experimental procedures
Cell culture and preparation of cell-free extracts
Synechocystis sp. PCC6803 cell culture and preparation of
cell-free extracts were carried ... small
molecular weight chemical chelators (natural chelate
compounds and synthetic chelate compounds), transfer-
rin and ferritin could be substrates of the ferric reduc-
tase activity of DrgA protein. ...
- 10
- 338
- 1
Báo cáo khoa học: Revisiting the prediction of protein function at CASP6 potx
Ngày tải lên :
30/03/2014, 10:20
... Techniques for
Protein Structure Prediction (CASP);
function prediction; protein function;
structural genomics
Correspondence
A. Tramontano, Department of Biochemical
Sciences ‘A. Rossi Fanelli’, University ... residue identifier; CASP, Critical
Assessment of Techniques for Protein Structure Prediction; GOC, GO cellular component number; GOF, GO molecular function number;
GOP, GO biological process number; ... S1. Percentage of consensus predictions as a func-
tion of the redundancy [F(red)] of the contributing
methods. (A) GOF functional class; (B) GOP func-
tional class; (C) GOP functional class,...
- 7
- 280
- 0
- c reactive protein
- c reactive protein positive
- c reactive protein and cancer
- c reactive protein low
- c reactive protein cardiac
- c reactive protein normal levels
- c reactive protein high
- c reactive protein range
- c reactive protein test
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2