c in addition each line or paragraph containing trade secrets or commercial or financial information that is privileged must be marked with brackets or other clear identification such as highlighting
FINANCIAL ASSISTANCE FUNDING OPPORTUNITY ANNOUNCEMENT - Small Business Innovation Research (SBIR) pdf
... or financial information that is privileged or confidential and exempt from public disclosure.” (c) In addition, each line or paragraph containing trade secrets or commercial or financial information ... or financial information that is privileged or confidential and exempt from public disclosure.” (3) In addition, each line or paragraph containing trade secrets or commercial or financial information ... or financial information that is privileged or confidential must be specifically identified and marked with the following (please cut and paste): “May contain trade secrets or commercial or financial...
- 62
- 761
- 0
The right of Matthew Harrison to be identified as the author of this work has been asserted in accordance with the Copyright, Designs and Patents Act 1988 No part of this publication may be reproduced in any material form (including photocopying or stori
... thất 24 Đèn c nh báo đèn phanh 25 Đèn c nh báo l c hạt diesel 26 Đèn báo lỗi m c kéo 27 Đèn c nh báo lỗi hệ thống treo 28 Đèn c nh báo chuyển đường 29 Đèn c nh báo lỗi chuyển đổi x c t c 30 Đèn ... hết pin 16 Đèn c nh báo khoảng c ch 17 Đèn báo nhấn chân c n 18 Đèn báo nhấn chân phanh 19 Đèn báo khóa vô-lăng 20 Đèn báo bật đèn pha 21 Đèn báo áp suất lốp m c thấp 22 Đèn báo thông tin đèn ... kính chắn gió 59 Đèn báo c p xe mở 60 Đèn báo tắt hệ thống c n điện tử 61 Đèn báo c m ứng mưa 62 Đèn c nh báo động c /khí thải 63 Đèn báo làm tan băng c a sổ sau 64 Đèn báo c n gạt kính chắn...
- 3
- 508
- 0
The right of Matthew Harrison to be identified as the author of this work has been asserted in accordance with the Copyright, Designs and Patents Act 1988 No part of this publication may be reproduced in any material form (including photocopying or stori
... your girlfriend Be going to: Chỉ hành động c dự tính trư c dự đoán c sở VD: You are going to fail Be + Ving: Chỉ hành động c dự tính chắn, kế hoạch chuẩn bị VD: I’m passing this final test III ... she is the more selfish she becomes The more intelligent he is the lazier he becomes Dạng kh c( càng ) The + S + V + the + comparative + S + V Vd: the more we study the more stupid we feel Chú ... Chủ từ c or , either or , neither nor , whether or, not only but (also)… chia theo chủ từ phía sau Vd: Neither James nor Lily SURVIVES C n 1001 quy t c biết nhiêu rồi… I C u hỏi Wh C c câu...
- 7
- 425
- 0
Báo cáo khoa học: "iomass of root and shoot systems of Quercus coccifera shrublands in Eastern Spain" pptx
... biomass (kg m–2 D.M.) and age (years) of Quercus coccifera shrublands at Valencia (Eastern Spain) Vertical lines indicate mean confidence interval at 95% (prescribed fire, browsing, cutting) in order ... soil belongs to the Calcic Cambisol–Calcaric Regsol association [11] The potential vegetation is an evergreen sclerophyllous forest: Bupleuro-Quercetum rotundifoliae with Pistacia lentiscus [36] ... living from dead fine roots because the criteria for such decision was not clear in field and the live-dead fine root percentage changes along the year [20, 22] For this reason the percentage given...
- 8
- 276
- 0
Rethinking Livelihoods, Forest Governance and Socioecological Systems: The State of REDD+ in Vietnam
... of capital (see Table 2.1) which each household and community at a certain point in time has access to Capital is considered to be a stock of material or information that exists at a point in ... dominant actors in any society Representational space or the live spaced is conceived by our senses or physical experience It is the space that is ‘directly lived, or in other words: the ‘dominated ... Emissions from Deforestation and Forest Degradation (REDD+) programme is offering developing countries financial incentives by creating financial values for the carbon stored in forests The main...
- 381
- 811
- 0
Tài liệu Báo cáo khoa học: Three-dimensional structures of thermophilic b-1,4-xylanases from Chaetomium thermophilum and Nonomuraea flexuosa Comparison of twelve xylanases in relation to their thermal stability pdf
... organisms essentially not differ in packing They suggest that neither the reduction in packing density nor the reduction of the packing defects can be considered as a common mechanism for increasing ... without GlcNAcs had been crystallized or that the GlcNAc is disordered According to the mass spectrum, approximately 20% of the material did not contain GlcNAc or alternatively, the GlcNAc had been ... may benefit from the better packing Adaptation to alkaline pH might also benefit from better packing Hydrophobicity and surface characteristics Because protein cores are typically hydrophobic, increased...
- 14
- 520
- 0
Tài liệu Báo cáo Y học: Human and Drosophila UDP-galactose transporters transport UDP-N-acetylgalactosamine in addition to UDP-galactose doc
... 5¢-GTCTTTGTTTCGTTTTCTGTTCTG-3¢ 5¢-GGCATTCTGGAGCACCAGCA-3¢ 5¢-GGCAGCCTGGACCACCAGCA-3¢ 5¢-TGCTGAGGGTGAGGGAGGC-3¢ 5¢-ACCCCTCTTCTCTGCGAAGAGC-3¢ 5¢-GGCAACATACGCGAGGTTATT-3¢ 5¢-GCTGCAGTGGGCCTCCCTGCTGATGCTCTTCACTGG-3¢ ... 5¢-CGGCGGGCTACTGACGGCTGTGGTTGTCA-3¢ 5¢-ACCCTTTAAGCCCCGCCCCATTTA-3¢ 5¢-CTGGTTCTCTTCCTCCATGAG-3¢ 130 H Segawa et al (Eur J Biochem 269) YPYDPDYA was introduced to the C- terminus of DmNST by PCR ... using 5¢-DmNST (5¢-TAGAATTCTA GCACCATGAATAGC-3¢) and 3¢-DmNST-HA (5¢-CCG CGGCCGCTCATGCGTAATCCGGAACGTCGTAG GGGTAGACGCGCGGCAGCAG-3¢) as primers and clone GH2865 as the template Nucleotide sequences...
- 11
- 477
- 0
Báo cáo khoa học: Cas utilizes Nck2 to activate Cdc42 and regulate cell polarization during cell migration in response to wound healing docx
... Percentage of cells with Cdc42 localized on the leading edge A CasKo CasWt 70 60 50 40 30 20 * 10 CasKo CasWt 20 µm B Time (h) CasWt CasKo Active Cdc42 Total Cdc42 Active Cdc42 Total Cdc42 CasKo ... by transfecting CasKo cells with wild-type Cas) Cas expression in CasWt cells was similar to that in Balb3T3 cells, and Cas was absent in CasKo cells (Fig 1A) As shown in Fig 1B, CasWt cells migrated ... found that activation and localization of Cdc42 on the leading edge of cells was disrupted in CasKo and Cas siRNA-transfected cells, indicating that Cas is crucial for the regulation of Cdc42 activity...
- 12
- 355
- 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf
... sequence homologies to these Hsp90s but 5¢ homologies to plasmid pBDC [34] (Hsp90a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; ... Hsp90a ORF using the forward primer AAATAAGTCG ACATGCCTGAGGAAACCCAG (SalI site underlined; Hsp90a start codon in bold) and the reverse primer CTTC ATCTGCAGTTAGTCTACTTCTTCCAT (PstI site underlined; ... Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse primer CA GTAGCTTCATCTTTCGATCGACTTCTTCCATGCGA GA) The second PCR used a universal pair of primers [34,48] PJ69-4a [48] was...
- 11
- 427
- 0
Báo cáo y học: "Inhibition of antithrombin by hyaluronic acid may be involved in the pathogenesis of rheumatoid arthritis" potx
... USA) at 37 C in working buffer (100 mmol/l Tris-HCl, pH 7.5) containing mmol/l CaCl2 or FeCl3 The concentration of antithrombin was determined according to its physiologic level in synovial fluid ... 37 C for 24 hours in the presence of CaCl2, FeCl3, KCl, MgCl2, and NaCl at various concentrations Residual antithrombin activity was measured as described above Results In the absence of heparin, ... arginine to citrulline, is closely associated with RA [33] We recently found that recombinant human PADI4 protein inactivated human antithrombin III via citrullination in vitro We also detected...
- 6
- 437
- 0
Báo cáo y học: "CD40mAb adjuvant induces a rapid antibody response that may be beneficial in post-exposure prophylaxis" pptx
... accordance with strict Home Office guidelines Ovalbumin (Sigma) was conjugated to the CD40mAb 1 0C8 [22] as previously described [16] Four groups of 15 mice were immunised intraperitoneally with ... MB, Garcia C: Postexposure varicella vaccination in siblings of children with active varicella Pediatr Infect Dis J 1998, 17:256-257 Kohl I, Nemecek V, Summerová M, Chlíbek R, Nad’ová K, Mináriková ... TA, Carlring J, Heath AW: Co-stimulatory agonists as immunological adjuvants Vaccine 2006, 24:3399-3407 De Gregorio E, D’Oro U, Wack A: Immunology of TLR-independent vaccine adjuvants Curr Opin...
- 3
- 245
- 0
báo cáo khoa học: " The acceptability and feasibility of peer worker support role in community based HCV treatment for injecting drug users" pot
... need to incorporate HCV issues into all assessments of injecting drug users in specialist or GP settings, promote access to ongoing monitoring (screening every 6–12 months), and recognise that treatment ... better access services The Healthy Liver Clinic (HLC) was established in 2006 as part of the Turning Point Alcohol and Drug Centre's clinical services Turning Point is a multidisciplinary drug ... worker was not involved in the analysis to reduce conflicting interests It is apparent that this service model is also resource intense Although it can be argued that HCV treatment of injecting...
- 9
- 303
- 0
Báo cáo y học: "Noninvasive mechanical ventilation may be useful in treating patients who fail weaning from invasive mechanical ventilation: a randomized clinical trial" pps
... clinical pulmonary infection score (CPIS) was also assessed on days and 3, and pneumonia was diagnosed when CPIS was or greater, according to the protocol followed in our service [23-25] Sepsis was ... was defined as a systemic inflammatory response syndrome (SIRS) associated with infection SIRS was defined as a systemic inflammatory response to several severe clinical insults, which included ... the beginning of IMV, according to our service's routine Statistical analysis Microsoft Excel 2000 software (Microsoft Corporation, Redmond, WA, USA) was used to store data Statistical analysis...
- 8
- 233
- 0
Báo cáo y học: "Combining multicriteria decision analysis, ethics and health technology assessment: applying the EVIDEM decisionmaking framework to growth hormone for Turner syndrome patients" ppt
... decisionmaking body Not applicable for case study Q2 Completeness and consistency of reporting evidence Epidemiology: limited statistical information; Clinical data: Many gaps/inconsistent limited reporting ... medical issue for very short patients Impact: Therefore for very small patients, there is a medical utility in facilitating normal functioning (reaching car pedals, kitchen cabinets etc), which ... value Opportunity costs- Opportunity costs include resources or existing interventions efficiency* that may be forgone if intervention under scrutiny is used/ reimbursed Such consideration is aligned...
- 15
- 326
- 0
Báo cáo y học: "Advances in understanding the regulation of apoptosis and mitosis by peroxisome-proliferator activated receptors in pre-clinical models: relevance for human health and disease" potx
... corepressors, such as the nuclear receptor corepressors (or RXR-interacting protein 13) and the silencing mediator for retinoid and thyroid hormone receptors [18,24,25] When co-transfected into cell lines, ... translocase [53] Recently, the idea of a link between PPARγ and the insulin signaling has been reinforced by the finding that the c- Cbl-associated protein, a signaling protein interacting with the insulin ... majority of human colorectal cancers, APC is inactivated by deletions, thus giving rise to increased levels of β-catenin/TCF-4 mediated transcriptional activity PPARβ is, beside c- myc and cyclin...
- 15
- 437
- 0
Báo cáo y học: " A mechanistic model of infection: why duration and intensity of contacts should be included in models of disease spread" ppt
... than short contacts because they more often involve closer interaction, such as physical contact and kisses This finding is plausible because those persons with whom the individuals spend much time ... potentially contagious contact is defined as (1) a mutual conversation of more than 10 words within a short distance (
- 10
- 346
- 0
PURIFICATION OF SIMPL ANTIBODY AND IMMUNOFLUORESCENCE OF SIMPL SUB-CELLULAR LOCALIZATION IN RESPONSE TO TNFα- AND IL-1
... Domain Risc RNA-induced silencing complex SIMPL signaling molecule that interacts with mouse pellelike kinase x TIGM Texas Institute for Genomic Medicine Tlr Toll-like receptor TNFα Tumor Necrosis ... spectrometry (Lal et al 2005) Cellular based assays that utilize antibodies include immunofluorescence microscopy and fluorescence activated cell sorting (FACS) In immunofluorescence microscopy, ... trap vector present in intron would be excised in this sequence allowing for expression in SIMPL KO mice E Immunofluorescence SIMPL protein exhibits passive nuclear localization and is concentrated...
- 63
- 162
- 0
a study on teachers and students attitudes towards the cultural content in the international commercial textbook for non english majors at haiphong private university
... that such interaction is an enriching experience.”(p.10) As the result, besides linguistic competence, intercultural competence becomes inseparable in language learning and teaching Another issue ... attitudes of teachers towards teaching in general and teaching culture in specific also determine the way they teach For instance, is the teachers support learning and teaching target cultures, they ... the many aspects of a person‟s culture The last line is crossing disciplinary boundaries; the teaching of culture is linked to the academically recognized disciplines of anthropology, sociology,...
- 79
- 667
- 3
Báo cáo hóa học: " Research Article Meta-Model and UML Profile for Requirements Management of Software and Embedded Systems" pot
... building by preventing forming illegal relationships Other approach for this type of constraining would be to use a separate constraining language such as OCL Such approach would be more portable ... step is requirements specification This step is creating or changing requirements documentation based on the elicitation and analysis The documentation can be in form of electronic document or internal ... refined and they become closer to actual design components when information in the project is increased Various design decisions during the project lead into decomposition of the system into smaller...
- 14
- 437
- 1
Research Issues in Systems Analysis and Design, Databases and Software Development doc
... product The whole production is conducted according to the customer needs, which is still exceptional in Copyright © 2007, IGI Global Copying or distributing in print or electronic forms without ... approaches can be condensed into (or at a minimum contain) four critical steps: analysis, design, coding, and testing Copyright © 2007, IGI Global Copying or distributing in print or electronic forms ... Application Portfolio Case Company The case organization is a corporate communications agency that was founded in 1986 It is a part of an international network of advertising, marketing, communications,...
- 296
- 417
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25