brachypodium distachyon a new model system for structural and functional analysis of grass genomes

Báo cáo sinh học: "he water flea Daphnia - a ‘new’ model system for ecology and evolution" potx

Báo cáo sinh học: "he water flea Daphnia - a ‘new’ model system for ecology and evolution" potx

Ngày tải lên : 06/08/2014, 19:21
... insect-crustacean sister-group relationship is mainly based on the comparative analysis of neural characters in higher crustaceans (malacostracans) and insects For example, in both insects and malacostracans, ... Predators are not the only natural enemies of Daphnia The study of parasites (viruses, bacteria and multicellular parasites) has also gained momentum as a result of their influence on Daphnia ecology ... crustaceans are far from being resolved Several morphological and molecular studies have questioned the monophyly of crustaceans, and either Branchiopoda (such as Daphnia) or Malacostraca (lobster,...
  • 4
  • 318
  • 0
Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

Ngày tải lên : 07/03/2014, 16:20
... GAATCATTATGAAGCGGTGAGAGCTAATTTTGAAGG TGCTCGTACGCTGCAGGTCGAC TATTTACAAATTTACCTATACGCTCTGAGTTGATATTAC ATCGATGAATTCGAGCTCG GCTAATAACAACTAATATCACTAACAGAAGACCATTAC CCCGTACGCTGCAGGTCGAC GGAGGATTTATCAAAAGCTACTTCGAAAGCTAGGAACG ... CCTTCTTTGATTGTGCTGCAGAACGTTGAGGCTCTATT TGG CCAAATAGAGCCTCAACGTTCTGCAGCACAATCAAAGA AGG CGGATCCATGGTTAAAGATATTATCGAAAGGCATTTGC CCGCATGCGGCCGCTCAAGATGGTGTAAACGCACTAA GCG CACTAGCAGAACGTACTACGGTGTGGTTTATACAAGAG GGTTCCAGCTGAAGCTTCGTACGCT ... TCTAAGCTTGAGCTCTTTCACATAAGGGAGAGTCG CTGTATTCTATTTTTTCAAGAGTTCGATTCTATTG CAATAGAATCGAACTCTTGAAAAAATAGAATACAG CTTCTCTACGCCCGTGCTC GGAGGATCCGTCGACCATGACGACGACCAAGAG CCTTCTTTGATTGTGCTGCAGAACGTTGAGGCTCTATT...
  • 12
  • 584
  • 0
Báo cáo khoa học: Structural and functional analysis of ataxin-2 and ataxin-3 potx

Báo cáo khoa học: Structural and functional analysis of ataxin-2 and ataxin-3 potx

Ngày tải lên : 30/03/2014, 15:20
... is an important multifunctional AAA+ ATPase with two Cterminal ATPase domains after the adaptor domain, which provide the energy for major conformational changes [124] VCP forms hexamers and ... molecular basis for ARF binding and membrane association of GGAs Dev Cell 4, 321– 332 Shiba, T., Kawasaki, M., Takatsu, H., Nogi, T., Matsugaki, N., Igarashi, N., Suzuki, M., Kato, R., Nakayama, ... which is a U box homologue of yeast Ufd2 [128], and interacts with and regulates the degradation of the proteasome-associated ataxin-3, forming a trimeric complex of ataxin-3, VCP, and UFD 2a [96,127,129–131]...
  • 16
  • 526
  • 0
Structural and functional analysis of critical proteins involved in mRNA decay

Structural and functional analysis of critical proteins involved in mRNA decay

Ngày tải lên : 14/09/2015, 22:22
... binding channel, and a cycle of conformational change coupled to ATP binding and hydrolysis These conformational changes alter the likely ssRNA-binding channel in a manner that can explain how ATP ... (2005) have shown that Upf1, the central player of the surveillance complex, and ATR, a critical regulator of the DNA-damage-checkpoint pathway, are required for the degradation of histone mRNAs A ... Cunningham et al., 2000), which have a wide variety of endonucleolytic cleavage sites The general pathways of eukaryotic mRNA decay are illustrated in Figure 1-1 and critical enzymes and regulators are...
  • 191
  • 313
  • 0
A NEW CLASSIFICATION SYSTEM FOR URBAN STORMWATER POLLUTANT LOADING: A CASE STUDY IN THE SANTA MONICA BAY AREA

A NEW CLASSIFICATION SYSTEM FOR URBAN STORMWATER POLLUTANT LOADING: A CASE STUDY IN THE SANTA MONICA BAY AREA

Ngày tải lên : 05/09/2013, 09:08
... pollutant loads per unit pixel and unit rainfall for each water quality parameter i and α is a normalization factor that depends on units and conversion factors Table Runoff coefficient and EMCs for ... compared with official land used data obtained from SCAG land use data The pollutant loading maps of all water quality parameters show that the low pollutant emitting areas correspond to open land use ... provides practical information with reasonable accuracy, which can be used for environmental planning and management Open land use corresponds to low pollutant loads for all water quality parameters...
  • 7
  • 575
  • 0
báo cáo hóa học:" Research Article A New Denoising System for SONAR Images" docx

báo cáo hóa học:" Research Article A New Denoising System for SONAR Images" docx

Ngày tải lên : 21/06/2014, 20:20
... domain,” in Proceedings of International Conference on Advances in Stochastic Modelling and Data Analysis (ASMDA ’07), pp 1275–1281, Chania Crete, Greece, May-June 2007 [24] F Argenti and L Alparone, ... Neighborhoods of coefficients at adjacent positions (intrascale dependence) and scales (interscale dependence) are modeled as the product of two independent random variables: a Gaussian vector and a hidden ... to a higher value of local variance is richer than the frequency content of a class that corresponds to a smaller value of local variance So, for the fusion of a class corresponding to a smaller...
  • 14
  • 326
  • 0
Báo cáo y học: "Determination of normal values for navicular drop during walking: a new model correcting for foot length and gender" ppt

Báo cáo y học: "Determination of normal values for navicular drop during walking: a new model correcting for foot length and gender" ppt

Ngày tải lên : 10/08/2014, 21:23
... took part in data acquisition, made the statistical analysis and interpretation of data, and helped drafting the manuscript OS and HL took part in revising the manuscript critically for important ... calcaneus and first metatarsal head The distance between the floor and the line in standing position between the markers on calcaneus and first metatarsal were added afterwards ND was calculated ... primarily based upon 3-D video analysis By the introduction of VSA we have demonstrated that a 2-D video system can be at least as reliable as the multiple camera systems in the traditional 3-D analysis...
  • 7
  • 461
  • 0
báo cáo khoa học: "Brachypodium distachyon: a new pathosystem to study Fusarium head blight and other Fusarium diseases of wheat" pdf

báo cáo khoa học: "Brachypodium distachyon: a new pathosystem to study Fusarium head blight and other Fusarium diseases of wheat" pdf

Ngày tải lên : 11/08/2014, 11:20
... spray and point inoculations, disease assessments and detached leaf assays and normal light and SEM microscopy analysis GB carried out Bd root inoculations and CLSM analysis of root tissues and participated ... plant model available, Arabidopsis thaliana, because it is ideally suited to laboratory studies and there are extensive genetic and genomic resources available [20] Floral and foliar bioassays ... participated to Bd detached leaf assays AS and PN took part in designing and supervising the study and participated in drafting the manuscript All authors have read and approved the final manuscript...
  • 14
  • 342
  • 0
Báo cáo y học: " A new miniaturized system for extracorporeal membrane oxygenation in adult respiratory failure" potx

Báo cáo y học: " A new miniaturized system for extracorporeal membrane oxygenation in adult respiratory failure" potx

Ngày tải lên : 13/08/2014, 20:21
... has made important and substantial contributions to design, acquisition of data, analysis and interpretation of data and drafted the manuscript AP, AL, CK, TB, LR, JL and ML have made substantial ... substantial contributions to treatment of patients, acquisition of data, interpretation of data and revised the manuscript critically JW has made substantial contribution to acquisition of data and analysis ... integrated battery for transport The membrane oxygenator (PLS-QuadroxD, Maquet-Cardiopulmonary-AG) is made of polymethylpentene, which avoids plasma-leakage and has a total gas exchange surface of...
  • 10
  • 322
  • 0
A reliability data base for performance and predictive assessment of electric power systems

A reliability data base for performance and predictive assessment of electric power systems

Ngày tải lên : 03/01/2014, 19:36
... frequency and duration analysis The additional parameters required for such an analysis are the transition rates associated with the appropriate generating unit model The ERIS data base contains all ... Billinton and Allan ( ) that a three-state (UP, DOWN and one DERATED W N W Figure Three-state generating unit model Adequacy Assessment at Hierarchical Level I Generating capacity adequacy evaluation ... carrying capabilities of a unit or a system of units A detailed multistate model provides a more valid representation A generating unit can exist in a large number of derated states and therefore...
  • 6
  • 482
  • 0
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

Ngày tải lên : 18/02/2014, 16:20
... from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT TTCCTGTTCCAGCCACAAAAAT), with the altered ... bold and underlined The F13 3A mutation was created using the following primers: F133Afw (5¢-GTGGCTGGAACAGGAGCGCCATATTTTACA ACTGATTCG) and F13 3A- rv (5¢-CGAATCAGTTGTAA AATATGGCGCTCCTGTTCCAGCCAC) ... the lack of GTP activation [8] A comparison of UMPKs from U parvum, E coli and S solfataricus, chosen to represent mycoplasma, bacteria and archaea, showed that they all shared the same fold As...
  • 12
  • 656
  • 0
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Ngày tải lên : 07/03/2014, 04:20
... 5¢-CAAATTGGGGG CCCAGCAGCTGGGAAGTCTGAA-3¢ and 5¢-TTCAGA CTTCCCAGCTGCTGGGCCCCCAATTTG-3¢ for E19 9A, and 5¢-GAAGCTGGGAAGTCTGCACAGTCTGGAGCC AAG-3¢ and 5¢-CTTGGCTCCAGACTGTGCAGACTTCC CAGCTTC-3¢ for E20 4A ... 5¢-TTCGA GGCCCGCGCCGCAATTGGGGGCCCAGAA-3¢ and 5¢TTCTGGGCCCCCAATTGCGGCGCGGGCCTCGAA-3¢ for E19 0A, 5¢-ATTCCGGTTACTTTCGCGGCCCGCGC CCAAATT-3¢ and 5¢-AATTTGGGCGCGGGCCGCGA AAGTAACCGGAAT-3¢ for E19 0A, 5¢-CAAATTGGGGG ... thyroglobulin (mass of 669 kDa) and apoferritin (mass of 443 kDa) (Fig 4), with an average molecular mass of 613 ± 185 kDa, as calculated from the standard curve (not shown), corresponding to an average...
  • 14
  • 417
  • 0
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

Ngày tải lên : 16/03/2014, 00:20
... (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA ... protease aprE, at the transcriptional level [6] and, for that reason, TenA is often classified as ‘putative transcriptional regulator’ (http:// au.expasy.org/) A comparative analysis of several fully ... human gastric mucosa It has been associated with the development of several diseases, such as chronic gastritis, gastric and duodenal ulcer, gastric adenocarcinoma and mucosa-associated lymphoma...
  • 9
  • 491
  • 0
Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

Ngày tải lên : 24/03/2014, 03:21
... grade Purification of smelt AFP Blood plasma was obtained from a population of rainbow smelt (O mordax) caught in seawater along the northeastern coast of Newfoundland on 20 February 1997 and stored ... band corresponded to the gradual increase in intensity of a higher-molecular-mass band The apparent molecular mass of this band was 38 kDa, which is substantially higher than the molecular mass ... was also analyzed on the same column and found to have a molecular mass of 41 kDa, which also indicates dimer formation (not shown) Fig HPLC gel-filtration analysis of smelt AFP Smelt AFP was applied...
  • 8
  • 518
  • 0
Báo cáo khoa học: "Structural and functional characterization of the 5’ upstream region of a glutamine synthetase gene from Scots pine" pdf

Báo cáo khoa học: "Structural and functional characterization of the 5’ upstream region of a glutamine synthetase gene from Scots pine" pdf

Ngày tải lên : 08/08/2014, 14:20
... were used as controls 2.4 Gel retardation analysis A DNA fragment used for gel retardation analysis containing a sequence from the 5’-untranslated region of GS 1a was obtained by cleavage with ... infiltration of adult Arabidopsis thaliana plants, CR Acad Sci Paris, Life Sciences 816 (1993) 1194–1199 [6] Cánovas F.M., Cantón F.R., Gallardo F., Garc a- Gutiérrez A. , de Vicente A. , Accumulation ... obtained in the gel retardation assay The 173 bp long AT–1 fragment (starting at –720 bp) formed a complex that migrated more slowly than free DNA and that was not seen in the absence of nuclear...
  • 6
  • 327
  • 0
Báo cáo y học: "Structural and functional map of a bacterial nucleoid" doc

Báo cáo y học: "Structural and functional map of a bacterial nucleoid" doc

Ngày tải lên : 09/08/2014, 20:21
... phases - that is, lag, early, mid, and late exponential and early and late stationary phases With these data, investigators should be able to obtain a dynamic picture of protein occupancy for ... supercoiling - a global transcriptional regulator for enterobacterial growth? Nat Rev Microbiol 2005, 3:157-169 Ali Azam T, Iwata A, Nishimura A, Ueda S, Ishihama A: Growth phase-dependent variation in ... E: Functional consequences of improved structural information on bacterial nucleoids Res Microbiol 1991, 142:229-238 Vora T, Hottes AK, Tavazoie S: Protein occupancy landscape of a bacterial...
  • 4
  • 307
  • 0
báo cáo khoa học: " Characterization of cp3 reveals a new bri1 allele, bri1-120, and the importance of the LRR domain of BRI1 mediating BR signaling" doc

báo cáo khoa học: " Characterization of cp3 reveals a new bri1 allele, bri1-120, and the importance of the LRR domain of BRI1 mediating BR signaling" doc

Ngày tải lên : 11/08/2014, 11:21
... we added 20 μM of IAA, GA, kinetin, and ACC and 50 μM of JA to 1/2 MS MS plates and processed them the same way All of the chemicals were purchased from Duchefa Biochemie except IAA (Sigma Aldrich) ... we PCR-amplified the genomic DNA with specifically designed dCAPS primers 5’- ccgcttcgttgctaacgttagatctaagct-3’ (forward) and 5’-ccagttaagattggtacagttacttaaacc-3’ (reverse), to generate a HindⅢ ... bri1 mutant alleles are dispersed in both an extracellular domain and a cytoplasmic kinase domain [4,16] The extracellular domain of BRI1 consists of LRRs and a 70-amino acid island containing unique...
  • 11
  • 389
  • 0
Báo cáo y học: "Structural and functional aspects of liver sinusoidal endothelial cell fenestrae: a review" ppsx

Báo cáo y học: "Structural and functional aspects of liver sinusoidal endothelial cell fenestrae: a review" ppsx

Ngày tải lên : 13/08/2014, 13:20
... M, Kamegaya Y, Yokomori H, Han JY, Akiba Y, Nakamura M, Ishii H, Tsuchiya M: Roles of plasma membrane Ca++ – ATPase in the relaxation and contraction of hepatic sinusoidal endothelial fenestrae ... hepatocellular carcinoma Arch Pathol Lab Med 1987, 111:174-180 Ichida T, Hata K, Yamada S, Hatano T, Miyagiwa M, Miyabayashi C, Matsui S, Wisse E: Subcellular abnormalities of liver sinusoidal ... Madarame T, Masuda T, Suzuki A, Satodate R, Suzuki K, Sato S: Ultrastructural features of the vascular channel of human and experimentally induced hepatocellular carcinoma In: Cells of the Hepatic Sinusoid...
  • 17
  • 360
  • 0
Structural and functional characterization of TRX16, a thioredoxinlike protein and altering substrate specificity of a serine protease inhibitor

Structural and functional characterization of TRX16, a thioredoxinlike protein and altering substrate specificity of a serine protease inhibitor

Ngày tải lên : 09/09/2015, 18:55
... Farré and Casado, 2001; Laroux et al., 2001), atherosclerosis and other cardiovascular disorders, inflammation and chronic inflammation (Laroux et al., 2001; Latha and Babu, 2001), burns (Latha ... structure, as structure and function go hand in hand Decades of effort using X-ray crystallography and NMR have produced thousands of protein and complex with binding partner structures and these ... and post ischemic e.g., damage to skin, heart, brain, kidney, liver, and intestinal tract pathologies (Sasaki and Joh, 2007) Table I.1: A partial list of diseases that have been linked to reactive...
  • 145
  • 254
  • 0
Structural and functional characterization of haditoxin, a novel neurotoxin isolated from the venom of ophiohagus hannah (king cobra

Structural and functional characterization of haditoxin, a novel neurotoxin isolated from the venom of ophiohagus hannah (king cobra

Ngày tải lên : 10/09/2015, 08:37
... Rajagopalan N, Nirthanan S, Bertrand D, Sivaraman J and Kini RM., Structural and functional characterization of a novel homodimeric three-finger neurotoxin from the venom of Ophiophagus hannah ... Chun Shin Foo, Nandhakishore Rajagopalan, Selvanayagam Nirthanan, Daniel Bertrand, J Sivaraman, R Manjunatha Kini ; The 24th Annual Symposium of the Protein Society San Diego, USA, August - 5, 2010 ... delivery apparatus like the fangs in the venomous snakes Living snakes are found on every continent except for Antarctica and few islands such as Ireland, Iceland, and New Zealand (Conant and Collins,...
  • 308
  • 442
  • 0

Xem thêm