automatic induction of a ccg grammar for turkish
Báo cáo khoa học: "Automatic Induction of a CCG Grammar for Turkish" pptx
Ngày tải lên :
17/03/2014, 06:20
... Hockenmaier. 2003. Data Models for statisti-
cal parsing with Combinatory Categorial Grammar.
Ph.D. thesis, University of Edinburgh.
Beryl Hoffman. 1995. The Computational Analysis of
the Syntax and ... categorial and phrase structure grammars. In
Language and Information ed. Bar-Hillel, Addison-
Wesley, pages 99–115.
Yehoshua Bar-Hillel. 1953. A quasi-arithmetic descrip-
tion for syntactic description. ... boost
the performances of statistical parsers from small
amounts of human labeled data.
Generalisation of this lexicon using the formalism
in Baldridge (2002) would result in a more compact
lexicon,...
- 6
- 373
- 0
Báo cáo khoa học: "Automatic Induction of Finite State Transducers for Simple Phonological Rules" pptx
Ngày tải lên :
08/03/2014, 07:20
... training
data coverage.
4 Using Alignment Information
Our first modification of OSTIA was to add the bias that,
as a default, a phoneme is realized as itself, or as a sim-
ilar phone. Our algorithm ... indicates any un-
stressed vowel, "v" any stressed vowel, 'dx' a flap, and
'C' any consonant other than 't', 'r' or 'dx'. '#' ... algorithm for learning them is an
extension of the OSTIA algorithm for learn-
ing general subsequential finite state transduc-
ers. Although OSTIA is capable of learning
arbitrary s f.s.t's...
- 7
- 313
- 0
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
Ngày tải lên :
12/02/2014, 10:20
... cttggggcct ctaaacgggt cttgaggggt 360
361 TTTTTGCTGA AAGGAGGAAC TATATCCGGA TATCCCGCAA 400
401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440
441 CATCCAGGGT
TTG
GACGGTGCCG AGGATGACGA TGAAGCGCCA 480 ...
taagacttttttacggcggcgctatcgctaacgggcccgcgc
attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg
I L K K C R R D S D C P G A
acgtaaacggcgccgttgccgataacgccgattgagctcggc
tgcatttgccgcggcaacggctattgcggctaactcgag
ccg
... gggcgcgtca 200
201 tttgccgcgg caacggctat tgcggctaac tcgagcccgg 240
241 gtgactgcag gaaggggatc cggctgctaa caaagcccga 280
281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320
321 tagcataccc cttggggcct...
- 9
- 497
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
Ngày tải lên :
18/02/2014, 17:20
... 5Â-CTC
GAGATGGATAAAGTTTTAAACAGAG-3Â and LTA-
1R, 5Â-TGAAGGCAAATCTCTGGAC-3Â for the former,
and LTAM2F, 5Â-CAGCTGTTTTGCTTGAATTATG-3Â
and LTA2R, 5Â-GAATTCATTATGTTTCAGGTTCA
GGGG-3Â for the latter. The ... long-term
culture of organ-specific blood vascular and lymphatic
endothelial cells of the mouse
Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,
Nobuaki Yoshida and ... vessel
endothelial hyaluronan receptor-1; MACS, magnetic-activated cell separation; MAPK, mitogen-activated protein kinase; PFA,
paraformaldehyde; Prox-1, prospero-related homeobox-1; SV40T Ag, SV40 large...
- 11
- 873
- 0
Tài liệu Báo cáo khoa học: "Automatic Extraction of Lexico-Syntactic Patterns for Detection of Negation and Speculation Scopes" pdf
Ngày tải lên :
20/02/2014, 04:20
... Related Work
Interest in the task of identifying negation and spec-
ulation scopes has developed in recent years. Rele-
vant research was facilitated by the appearance of a
publicly available annotated ... Journal of biomedical informatics,
34(5):301–310.
A. B. Clegg and A. J. Shepherd. 2007. Benchmark-
ing natural-language parsers for biological applica-
tions using dependency graphs. BMC bioinformatics,
8(1):24.
M.C. ... publicly available dataset annotated with nega-
tion/speculation cues and their scopes. It consists
of biomedical papers, abstracts, and clinical reports
(corpus statistics are shown in Tables 1 and...
- 5
- 543
- 1
Báo cáo khoa học: "Automatic construction of a hypernym-labeled noun hierarchy from text" docx
Ngày tải lên :
08/03/2014, 06:20
... amount of memory. With
50,000 nouns, we would initially require a
50,000 x 50,000 array of values (or a trian-
gular array of about half this size). With
our current hardware, the largest array ... Riloff and Shepherd (1997) and Roark and
Charniak (1998). Taking the head words of
each NP and stemming them results in data
for about 50,000 distinct nouns.
A vector is created for each ... and for each noun we construct a vector
of hypernyms, with a value of i if a word has
been seen as a hypernym for this noun and 0
otherwise. These vectors are associated with
the leaves of...
- 7
- 418
- 0
Báo cáo "Development of a software package for 3D structured mesh generation " pdf
Ngày tải lên :
14/03/2014, 13:20
... interface of the package
The package is designed with a main interface that allows users to input topographical elevation
data of the top (upper) surface of any 3D objects in the form of digitized ... viewing and presenting the topographic data and the
generated meshes. The package has been applied to the generation of 3D computational meshes
used as the input of a computational fluid dynamics ... equation (1) is just an one to
one inverse mapping between the 3D real computational domain and a rectangular domain in the
parametric space [1, 2, 5, 6].
For short, the formulae for Y and...
- 14
- 402
- 0
Báo cáo khoa học: Activation of Stat5 and induction of a pregnancy-like mammary gland differentiation by eicosapentaenoic and docosapentaenoic omega-3 fatty acids docx
Ngày tải lên :
16/03/2014, 10:20
... MCF-10 mammary epithelial cells, we
analyzed the effect of DPA, EPA, and DHA on acti-
vation of Jak2 and Stat5. Whereas DPA and EPA
activated Jak2 and Stat5, DHA did not induce Jak2
and Stat5 phosphorylation ... transgenic
mouse, fat-1 can convert n-6 to n-3 fatty acids and
Table 1. Analyses of fatty acid ratio and relative contents of n-3 PUFAs EPA, DPA, and DHA in mammary glands. Whole inguinal mammary
fat ... accumulation of n-3 PUFAs,
such as DPA and EPA, in the differentiated mammary
gland during pregnancy may act as a factor inducing
functional mammary gland differentiation mediated by
activation of Jak2 and...
- 12
- 421
- 0
Báo cáo khoa học: "PEAS, the first instantiation of a comparative framework for evaluating parsers of French" potx
Ngày tải lên :
17/03/2014, 22:20
... France
{gendner,gabrieli,jardino,monceaux,pap,isabelle,anne}@limsi.fr
Abstract
This paper presents PEAS, the first
comparative evaluation framework for
parsers of French whose annotation
formalism allows the annotation of both
constituents and functional relations. ... Annotation formalism
The definition of the annotation formalism is the
core element of the evaluation process. Indeed,
the formalism must have a coverage of
syntactical phenomena as broad as possible ... Therefore,
the need for a complete comparative evaluation
framework — including a pivot annotation
formalism, a reference treebank, evaluation
metrics and the associated software — is
increasing.
It is...
- 4
- 323
- 0
Báo cáo khoa học: Inhibition of a-synuclein fibrillization by dopamine analogs via reaction with the amino groups of a-synuclein Implication for dopaminergic neurodegeneration pot
Ngày tải lên :
23/03/2014, 15:20
... reactions of DA analogs with a- Syn and some amino acids. (A) UV-vis spectra of a- Syn
with DA, CA, HQ and Q after reaction for 24 h. The a- Syn alone sample was as a control. The concentration of a- Syn ... MTT
reduction ability of the cell culture after addition of a- Syn or DA was also measured as a comparison. The concentration of all a- Syn forms
for the MTT assay was 10 l
M. Data represented are mean ± ... Biological Sciences, Chinese Academy of
Sciences, Shanghai, China
2 Shanghai Institute of Materia Medica, Shanghai, China
3 Shanghai Institute of Nuclear Research, Shanghai, China
4 Bio-X Research...
- 12
- 414
- 0
Báo cáo khoa học: "Correlating Human and Automatic Evaluation of a German Surface Realiser" doc
Ngày tải lên :
23/03/2014, 17:20
... of automatic evalua-
tion methods for generation in terms of adequacy
and fluency on automatically generated English
paraphrases. They find that the automatic metrics
are reasonably good at measuring ... native
speaker judgements on automatically gen-
erated German text against automatic eval-
uation metrics. We look at a number of
metrics from the MT and Summarisation
communities and find that for a ... of the ACL-IJCNLP 2009 Conference Short Papers, pages 97–100,
Suntec, Singapore, 4 August 2009.
c
2009 ACL and AFNLP
Correlating Human and Automatic Evaluation of a German Surface
Realiser
Aoife...
- 4
- 285
- 0
Báo cáo khoa học: "AUTOMATIC ACQUISITION OF A LARGE SUBCATEGORIZATION DICTIONARY FROM CORPORA" doc
Ngày tải lên :
23/03/2014, 20:20
... learning a foreign
language.
A subcategorization frame is a statement of
what types of syntactic arguments a verb (or ad-
jective) takes, such as objects, infinitives, that-
clauses, participial ...
program that determines the arguments of a verb
using any combination of word order, case marking
and head agreement markers, as appropriate for
the language at hand. Indeed, since case-marking ... slightly (a
few repeated typos made it in, such as
acknowl-
ege,
a few oddities such as the spelling
garontee
as a 'Cajun' pronunciation of
guarantee
and a few
cases of mistakes...
- 8
- 342
- 0
Báo cáo khoa học: "The Design of a Computer Language for Linguistic Information" ppt
Ngày tải lên :
24/03/2014, 01:21
... International
and
Center for the Study of Language and Information
Stanford University
Abstract
A considerable body of accumulated knowledge about
the design of languages for communicating ...
structs
Clearly, the bare PATR-II formalism, as it was pre-
sented in Section 2.1, is sorely inadequate for any major
attempt at building natural-language grammars because of
its verbosity and redundancy. ...
Denotational Semantics
One reason for maintaining the simplicity of the bare
PATR-II formalism is to permit a clean semantics for the
language. We have provided a denotational semantics for
PATR-ll...
- 5
- 383
- 0
Evaluation of a diagnostic algorithm for smear-negative pulmonary tuberculosis in HIV-infected adults doc
Ngày tải lên :
29/03/2014, 03:20
... DipHIVMan (SA)
Objectives. To evaluate the diagnostic accuracy of and reduction
in diagnostic delay attributable to a clinical algorithm used
for the diagnosis of smear-negative pulmonary tuberculosis ... sputum smear,
15
these are unavailable in most primary care settings in South
Africa. It is often necessary to make a clinico-radiological
diagnosis of smear-negative TB (SNTB) using an algorithm ... radiograph; ADA = adenosine deaminase; CRP = C-reactive protein; Hb = haemoglobin.
5 probable TB
‡
cases (3
had military patterns on
CXR, and 2 had high ADA
levels in pleural effusion, all...
- 7
- 366
- 0
Báo cáo khoa học: "The Acquisition and Application of Context Sensitive Grammar for English" docx
Ngày tải lên :
31/03/2014, 06:20
... expressive approach, its many vari-
ations have found much use in application to natural lan-
guage applications and there is a broad literature on Aug-
mented Phrase Structure Grammar [Gazdar et. al. ... simplifies a linguist's
judgements and allows rapid accumulation of large
grammars.
ã CSG grammar generalizes in a satisfactory fashion
and our studies predict that a nearly-complete ac-
counting ...
strings of language for training a neural network. How-
ever although the resulting neural network was trained
as a satisfactory grammar, there was a problem of scale-
up. Training the network for...
- 8
- 478
- 0
