antimicrobial and anti adhesive potential of a biosurfactants produced by candida species
Báo cáo y học: "Anti-inflammatory potential of a malleable matrix composed of fermented whey proteins and lactic acid bacteria in an atopic dermatitis model" pot
Ngày tải lên :
11/08/2014, 08:21
... mice/group and two independent experiments The statistical analysis of data was performed by the biostatistical service of INRS-Institut Armand-Frappier Statistical analysis used was a repeated measure ... on Animal Care as specified in the Guide to the Care and Use of Experimental Animals (CISAU # 0306-01 and # 0410-01) Mouse atopic contact dermatitis (ACD) After a week adaptation in the animal ... PL participated in the design of animal studies, data interpretation and revised the manuscript for the intellectual content and language All authors read and approved the final manuscript Acknowledgements...
- 10
- 416
- 0
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
Ngày tải lên :
16/03/2014, 13:20
... La Jolla, CA, USA) with pET2 8a( +)-wild-type Ec DosH as a template and using the following respective 5¢-sense primers: 5¢-gatga gtcgggagACCcagctggagaaaaaag-3¢, 5¢-gatgagtcgggagTTTcag ctggagaaaaaag-3¢, ... Yokota et al Sato A, Sasakura Y, Sugiyama S, Sagami I, Shimizu T, Mizutani Y & Kitagawa T (2002) Stationary and timeresolved resonance Raman spectra of His77 and Met95 mutants of the isolated ... whereas Ala and Asn substitutions at Asp40, an amino-acid residue that interacts via two water molecules with the proximal ligand His77, markedly increased the rate of auto-oxidation [13] (Table...
- 14
- 390
- 0
Báo cáo hóa học: " Assessing agonistic potential of a candidate therapeutic anti-IL21R antibody" pptx
Ngày tải lên :
18/06/2014, 16:20
... supervised and participated in data analyses, and co-wrote the manuscript All authors have read and approved the final manuscript Acknowledgements We thank Sadhana Jain and Amy Weaver for pilot ... as ATR-107; RQ: relative quantification (of RNA) Page 10 of 11 Additional material Additional file Staining of lymphocytes with Ab-01 saturated at similar antibody concentrations in human and ... housed and cared for according to the American Association for Accreditation of Laboratory Animal Care guidelines The internal Institutional Animal Care and Use Committee approved all aspects of...
- 11
- 391
- 0
Báo cáo sinh học: "The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease" pdf
Ngày tải lên :
18/06/2014, 22:20
... in analyses and interpretation of data He drafted the manuscript AG has been involved in analyses and interpretation of data and statistical analysis She helped to draft the manuscript RC participated ... Cell viability was calculated by dividing the absorbance of wells containing samples by the absorbance of wells containing medium alone Statistical Analysis Statistical parameters (mean, standard ... (s.c.) at biweekly intervals Sera were collected 12 days after each immunization Detection of anti- Ab and anti- HA antibody responses using ELISA Concentration of anti- Ab antibody in sera of immunized...
- 15
- 431
- 0
Báo cáo hóa học: " Testing the potential of a virtual reality neurorehabilitation system during performance of observation, imagery and imitation of motor actions recorded by wireless functional nearinfrared spectroscopy (fNIRS)" potx
Ngày tải lên :
19/06/2014, 08:20
... the patient’s own arms and hands, which are displayed on a large screen and controlled by the patient wearing arm position trackers and data gloves To activate the action-observation system, patients ... moving hand, as assessed by fMRI and PET [30-33] Additionally, ipsilateral activation is both found in M1 and shifted laterally, ventrally, and anteriorly towards PMC for unimanual tasks with ... head using medical-grade, disposable, self -adhesive bandages (Derma Plast CoFix 40 mm, IVF Hartmann, Neuhausen, Switzerland) For final data processing, by measuring intensity of NIR light after...
- 13
- 577
- 0
Báo cáo y học: "The in vivo expression of actin/salt-resistant hyperactive DNase I inhibits the development of anti-ssDNA and anti-histone autoantibodies in a murine model of systemic lupus erythematosus" ppt
Ngày tải lên :
09/08/2014, 07:20
... units (AEU) relative to a standard positive sample that was assigned a value of 100 AEU The data are presented as mean ± standard error of the mean Statistics were performed comparing autoantibody ... (%) ash.DNase I = actin-resistant, salt-resistant and hyperactive mutant of DNase I; NS, not significant Total IgG antibodies to ssDNA and anti- chromatin antibodies were measured by ELISA as described ... development of anti- nuclear antibodies and associated pathology by reducing the circulating levels of antigenic nuclear components, we have taken advantage of the mutant murine DNase I constructs...
- 11
- 558
- 0
báo cáo khoa học: "The anti-myeloma activity of a novel purine scaffold HSP90 inhibitor PU-H71 is via inhibition of both HSP90A and HSP90B1" docx
Ngày tải lên :
10/08/2014, 22:21
... myeloma: results of a phase dose-escalation study Br J Haematol 150:438-445 Nakashima T, Ishii T, Tagaya H, Seike T, Nakagawa H, Kanda Y, Akinaga S, Soga S, Shiotsu Y: New molecular and biological ... designed and implemented the study, and drafted the manuscript RB and GC participated in the implementation of the study, and the acquisition, analysis and interpretation of data All authors have read ... The anti- myeloma activity of PUH71 and the geldanamycin analogues (17-AAG, 17-DMAG), which are all pan-HSP90 inhibitors, was, however, significantly reduced in the absence of gp96 This data suggests...
- 8
- 247
- 0
Báo cáo y học: " Early Anti-inflammatory and anti-arthritic effects of yucca schidigera: A review" pdf
Ngày tải lên :
11/08/2014, 08:21
... protozoal theory of causation of arthritis has any merit, a role of yucca in arthritis treatment can be advanced on the basis of the anti- protozoal activity of yucca saponins The chemistry and bioactivity ... effect of yucca on arthritis could involve antiprotozoal, anti- oxidant and anti- bacterial activities As previously mentioned, the drug metronidazole attenuates gastrointestinal inflammation and can ... action of yucca in preventing arthritis by anti- inflammatory activity Yucca contains anti- inflammatory polyphenolics such as resveratrol and yuccaols A, B, C, D and E [18,19] Yucca bark and whole...
- 7
- 369
- 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
Ngày tải lên :
14/02/2014, 19:20
... neuronal damage [33,34] The co-administration of antioxidants like coenzyme Q and creatine has also been shown to be beneficial against a- synuclein aggregation in the substantia nigra pars Modulation ... an important probe for characterization of the nature of the aggregates Characteristic sigmoidal curves of amyloid-type aggregates, Fig Aggregation of a- synuclein (A) Samples were withdrawn after ... 240 h Samples containing MPTP (A and C) and MPP+ (B and D) were analysed by SDS ⁄ PAGE (A and B) on 5–15% crosslinked polyacrylamide gel and western blotting (C and D) (A, B) Lane M, prestained...
- 11
- 754
- 0
Tài liệu FRONTIERS IN UNDERSTANDING CLIMATE CHANGE AND POLAR ECOSYSTEMS REPORT OF A WORKSHOP docx
Ngày tải lên :
17/02/2014, 19:20
... ecological approach of experimental manipulation to be possible or ethical (Blackburn and Gaston, 2003; Blackburn, 2004) Alaska populations of boreal plants and animals contain mixtures of Eurasian species ... are characterized by microbial, plant, and animal populations with life cycles and physiological requirements closely tied to the annual cycle of ice advance, duration, and retreat and available ... Sea ice also provides an important habitat for birds and mammals (e.g., penguins, polar bears, walrus, and seals) that use the ice as a foraging platform or breeding habitat Arctic and Antarctic...
- 87
- 467
- 0
Forest Economic and Environmental Accounting: A pilot study of a first implementation by Statistics Sweden docx
Ngày tải lên :
08/03/2014, 08:20
... systematic way to fit table Acquisition of land and land area There exist no information divided by industries of land area and acquisition or disposal of land At the best such information can be made ... categories, the State, Other public forests, Company forests and Private Tables 1-2 Table 1a and 2a Data on both area and volume for forest and other wooded land are based on data from the National ... hectare and year Rock surface: Land without a soil layer or the soil layer too shallow to allow a potential yield under ideal management conditions of at least m3 per hectare and year Scattered...
- 48
- 520
- 0
Gold, Peace, and Prosperity..Gold, Peace, and Prosperity:The Birth of a New Currency Second pptx
Ngày tải lên :
15/03/2014, 09:20
... delight of the bureaucrats, politicians, international bankers, multinational corporations, and some labor leaders The age of the managed fiat currency was born The M anaged Fiat Currency Standard As ... standard, the CPI increased 10 percent In his 1848 Communist Manifesto, Karl Marx urged: “Centralization of credit in the hands of the state, by means of a national bank with state capital and ... society and nation, but to adjust and discharge the balance of exchanges between different nations It must be something which has a value abroad, as well as at home, and by which foreign as well as...
- 111
- 1.2K
- 0
Báo cáo khoa học: Phosphorylation modulates the local conformation and self-aggregation ability of a peptide from the fourth tau microtubule-binding repeat pdf
Ngày tải lên :
16/03/2014, 05:20
... Correas I, Nieto A & Avila J (1988) Tau factor polymers are similar to paired helical filaments of Alzheimer’s disease FEBS Lett 236, 150–154 42 Mendieta J, Fuertes MA, Kunjishapatham R, SantaMaria ... shifts and negative values are upfield shifts NH and 0.10 p.p.m for aH) In general, the chemical shift of NH deviates was more than that of aH upon phosphorylation Notable chemical shift deviation of ... CD spectra for R4 and pR4 are characterized by a strong negative apex at 198 nm (Fig 3), which indicates a large amount of random coil structure [36] No remarkable structural perturbation is...
- 9
- 428
- 0
Measuring and modelling the performance of a parallel ODMG compliant object database server potx
Ngày tải lên :
17/03/2014, 00:20
... Objectivity/DB, GemStone and O2 A commercial parallel database management system is Teradata [37], which is a relational database system Teradata runs on a shared-nothing machine and implements partitioned, ... development of a parallel object database server is given in [14] An early parallel object database project was Bubba [15], which had a functional query language FAD Although the Bubba model and languages ... Muralikrishna M Gamma a high performance dataflow database machine Proceedings of the International Conference on Very Large Data Bases, Kyoto, Japan, August 1986 Morgan Kaufmann: San Mateo, CA,...
- 47
- 1.6K
- 0
synthesis, electrical measurement, and field emission properties of a-fe2o3 nanowires
Ngày tải lên :
20/03/2014, 13:08
... We assumed that q (4.42 103 Xcm) is a constant for all of the as -produced a- Fe2O3 NWs Using the mean length and radius of the NWs, RNW (or Roverall) of samples A, B, C, and D was calculated as ... Nanoscale Res Lett (2008) 3:330–337 331 thermally stable, resistant to oxidation, and have a high aspect ratio, a- Fe2O3 NWs are a candidate emitters for FE applications It has been reported ... process of the PR Figure 6a and b shows the morphology image and current image, respectively, taken at a ?10 V bias on a single NW The tip used for CAFM was an Au-coated silicon tip, with a diameter...
- 8
- 403
- 0
Báo cáo khoa học: Substrate specificity of the human UDP-glucuronosyltransferase UGT2B4 and UGT2B7 Identification of a critical aromatic amino acid residue at position 33 doc
Ngày tải lên :
23/03/2014, 09:21
... CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG CTGGTGTGGGCAGCAGAACTCAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGAGTTCTGCTGCCCACACCAG CTGGTGTGGGCAGCAGAATACAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGTATTCTGCTGCCCACACCAG ... Sense Antisense Sense Antisense Sense Antisense Sense Antisense CTGGTGTGGCCCACAGAACTCAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGAGTTCTGTGGGCCACACCAG CTGGTGTGGCCCACAGAATACAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG ... kit was from Stratagene (La Jolla, CA, USA), LumiGLOTM was from Cell Signaling (Beverly, MA, USA), and AdvantageÒ polymerase mix was from Clontech (Palo Alto, CA, USA) All other reagents were of...
- 9
- 343
- 0
ELECTRONIC SCIENTIFIC, TECHNICAL, AND MEDICAL JOURNAL PUBLISHING AND ITS IMPLICATIONS REPORT OF A SYMPOSIUM docx
Ngày tải lên :
29/03/2014, 11:20
... binding, and mailing costs True digital archives will have their standards and operational performances publicly known and monitored by publishers, researchers, and librarians alike The operations and ... well-known example of such an open access archive is PubMed Central, maintained by the National Library of Medicine Advantages of the Open-Access Approach for Science The practical advantages of true ... scientific and technical matters Dr Bruce M Alberts is president of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy...
- 122
- 405
- 0
Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot
Ngày tải lên :
30/03/2014, 15:20
... Ontario, Canada) or New England Biolabs (Pickering, Ontario, Canada) All other chemicals were of analytical grade and were obtained from Sigma-Aldrich and Fisher Scientific (Nepean, Ontario, Canada) ... 2-hydroxy-6oxohexa-2,4-dienoate (HODA) product from XylE cleavage of 4-cholorocatechol is also purified by ethylacetate extrac- 972 P Wang and S Y K Seah tion and analyzed by proton NMR and COSY using a Bruker ... kcat value compared with the methyl substituted substrate Discussion HPDA hydratase, an enzyme in the meta-cleavage pathway of aromatic compounds, catalyzes a hydration reaction via a proposed anion...
- 9
- 461
- 0