an active document is the product of a program sent from the server to the client and run at the client site

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efﬁciency doc

Ngày tải lên : 14/02/2014, 15:20

... describe the physical properties that relate to the catalysis of a newly isolated, dual-domain BPP (PhyH) from Bacillus sp HJB17 This enzyme is very active at neutral pH (6.0–8.0) and at low temperatures ... fused to another single-domain phytase may improve the catalytic efﬁciency of the latter Materials and methods Strains, plasmids and chemicals E coli Trans1-T1 (TransGen, Beijing, China) and pGEM-T ... sum of PhyH-DI and PhyH-DII and two times greater than that of PhyHDII This large variance cannot be ascribed to the function of PhyH-DI alone The dual-domain phytase was shown to be a dimer according...

9
801
0

Tài liệu Báo cáo khoa học: Inﬂuence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx

Ngày tải lên : 19/02/2014, 05:20

... conjugates were independent of the size of the glycan (Tables and 5, [36]) The analysis revealed that the changes in these parameters statistically correlate for both the acylation and deacylation ... Structural dynamics and serine protease catalysis Table Global energetic parameters and DebyeWaller temperature factors calculated for the protein portion of a- CT and the various lactose -a- CT conjugate ... Structural insights into the mechanochemical nature of a- CT catalysis A more detailed analysis of the inuence of chemical glycosylation on the dynamics of a- CT from the theoretical simulations was additionally...

17
531
0

The impact of a cancer Survivorship Care Plan on gynecological cancer patient and health car provider reported outcomes (ROGY Care): study protocol for a pragmatic cluster randomized controlled trial potx

Ngày tải lên : 05/03/2014, 15:20

... socioeconomic variables such as age, education, marital status, and employment status, and clinical variables such as cancer stage at diagnosis, time after diagnosis, and initial treatment All measures ... of a patient-tailored approach to information provision Providing information that is congruent with a patient’s needs at that particular time is an important determinant for patient satisfaction ... the patient’s care will be registered in ROGY and automatically updated in the personal SCP The ROGY system was set up to facilitate patient registration and improve patient care by means of uniform...

8
786
0

Báo cáo khoa học: Exosites mediate the anti-inﬂammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus potx

Ngày tải lên : 07/03/2014, 01:20

... cytokine analysis (MCP-1, TNF -a, IL-6, IL-10, IL-1b) All animals were maintained and handled according to local and national ethical guidelines Statistical analysis Data are represented as means ... (FNRS), the Fonds Jean Brachet, and the Fonds van Buuren to EG and LV and from the VIB to AB LV is Senior Research Associate at the Belgian FNRS PPP is an Associate Searcher at the Belgian FNRS ... centrifugation and 500-lL aliquots were placed in glass test tubes Radioactivity was measured using a gamma counter (LKB, Wallac, Finland) All animals were maintained and handled according to local and...

12
499
0

Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt

Ngày tải lên : 07/03/2014, 17:20

... isolation and DNase treatment were carried out as described at http://www microarrays.org/pdfs/Total_RNA _from_ Ecoli.pdf The RNA was dissolved in 50 lL of RNase-free water and the A2 60 and A2 80 values ... buffers as indicated The standard analysis program provided with the instrument was used for analysing the data Secondary structure elements were estimated by the cdnn program that utilizes a neural ... N-succinyltransferase Ribulose-phosphate 3-epimerase Antioxidant, AhpC ⁄ Tsa family protein Transketolase Translation elongation factor Tu ATP synthase F1, a- subunit Fig Genomic orientation (A) , nucleotide and...

13
501
0

Báo cáo khoa học: Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data docx

Ngày tải lên : 07/03/2014, 21:20

... information set at xi (Supplementary material, Supplementary mathematical descriptions, Definition 5), we can find the FNS at xi by excluding the INS at xi obtained at Step from the ANS at xi and thereby ... experimental data profiles and does not rely on the measured absolute value at each sampling time point This also implies that we can get an insight into the allowable error ranges in the measurements and ... temporal slope changes of the experimental data profiles, which is distinguished from any other approaches reported up to the present One of the major characteristics of the presented method is that...

10
375
0

Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx

Ngày tải lên : 16/03/2014, 13:20

... DosH as a template and using the following respective 5¢-sense primers: 5¢-gatga gtcgggagACCcagctggagaaaaaag-3¢, 5¢-gatgagtcgggagTTTcag ctggagaaaaaag-3¢, 5¢-ggacccgttttgcgACCtcgaaagtgagc-3¢, and ... states of Leu mutants of Ec DOS N Yokota et al Sato A, Sasakura Y, Sugiyama S, Sagami I, Shimizu T, Mizutani Y & Kitagawa T (2002) Stationary and timeresolved resonance Raman spectra of His77 and ... constants of 0.0063 and 0.049 min)1, for the wild-type and L99T mutant, respectively markedly decreased the rate of auto-oxidation [5], whereas Ala and Asn substitutions at Asp40, an amino-acid...

14
390
0

Báo cáo khoa học: Investigation of the substrate speciﬁcity of a b-glycosidase from Spodoptera frugiperda using site-directed mutagenesis and bioenergetics analysis pdf

Ngày tải lên : 16/03/2014, 18:20

... residue at position 39 and an equatorial 4-OH was called /4e, and between any residue at position 451 and an equatorial 4-OH was called g4e Interactions involving these same residues and an axial ... indicates a 6-deoxy monosaccharide (fucose; third column) 451 present higher kcat and kcat/Km values than mutant E45 1A The same is true between mutants at position 39 and mutant Q3 9A As the rate ... residue at position 451 were designated by g Glycone hydroxyls and were designated and 6, where ÔeÕ stands for an equatorial hydroxyl and a for an axial one Therefore, the interaction between any...

9
371
0

Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel speciﬁcity towards C-terminal glutamate residues pptx

Ngày tải lên : 23/03/2014, 12:20

... present in the databases The two proteins migrating at 50 and 55 kDa (bands A and B; Fig 1A) were identiﬁed from their N-terminal sequences as similar to a- amylase (accession no AAA17751) from ... C-terminal glutamate, and folate analogues, is present in mammalian nervous tissue and prostate [26] These enzymes all belong to clan MH of metalloproteinases, and have little sequence similarity ... cleavage alone was not sufﬁcient for activation After 20 digestion by trypsin, all of the procarboxypeptidase band at 50 kDa had been cleaved to 36 kDa and 13 kDa bands, but the carboxypeptidase...

12
458
0

Beethoven The story of a little boy who was forced to practice ppt

Ngày tải lên : 30/03/2014, 00:20

... links and up to date contact information can be found at the Foundation's web site and official page at http://pglaf.org For additional contact information: Dr Gregory B Newby Chief Executive and ... regulating charities and charitable donations in all 50 states of the United States Compliance requirements are not uniform and it takes a considerable effort, much paperwork and many fees to meet and ... Literary Archive Foundation The Project Gutenberg Literary Archive Foundation is a non profit 501(c)(3) educational corporation organized under the laws of the state of Mississippi and granted tax...

14
770
0

Báo cáo khoa học: An active triple-catalytic hybrid enzyme engineered by linking cyclo-oxygenase isoform-1 to prostacyclin synthase that can constantly biosynthesize prostacyclin, the vascular protector pot

Ngày tải lên : 30/03/2014, 02:20

... platelet aggregation stimulated by collagen and AA The platelet-rich plasma, prepared from fresh human blood, was incubated with 100 lM of collagen (bars and 2) or AA (bars and 4) at 37 °C in the ... on antiplatelet aggregation were explored It is known that platelets contain large amounts of COX-1 and thromboxane A2 synthase (TXAS) When AA was added to the platelet-rich plasma, the platelets ... downstream synthases, and is isomerized to prostaglandin D2, prostaglandin E2 (PGE2), prostaglandin F2 (PGF2), and prostaglandin I2 (PGI2) or thromboxane A2 (TXA2) by individual synthases (catalytic step...

10
246
0

Báo cáo khoa học: "The adaptation of a machine-learned sentence realization system to French" potx

Ngày tải lên : 31/03/2014, 20:20

... below the stages of the French system, and compare them to the German system Stage 1, the pre-processing of the data, involves language-neutral transformations from a graph representation to a tree ... specific to French In all cases, however, French uses the same strategy as German: exploit the full set of features available in the analysis on the node, its parent and grand-parent The sets of features ... each set of data we build decision trees at several levels of granularity and select the model with the maximal accuracy as determined on the parameter tuning set We attempt to standardize as...

8
295
0

Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

Ngày tải lên : 20/06/2014, 01:20

... Dutta P, Bhattacharya SK, Krishnan T, Kobayashi N, Naik TN: Genetic variability of human rotavirus strains isolated from Eastern and Northern India J Med Virol 2004, 72:156-161 Rahman M, Sultana ... from database, performed the sequences analysis and critically revised the manuscript 14 16 18 19 Acknowledgements We are grateful to Natalia Gudiño for the language corrections of the manuscript, ... by Rahman and his colleagues are indicated by ●; the four mutations plus others at the primer binding site by ❍; three out of the four mutations by ■, and three mutations plus others at the primer...

4
329
0

Báo cáo hóa học: " Research Article Design and Implementation of a Generic Energy-Harvesting Framework Applied to the Evaluation of a Large-Scale Electronic Shelf-Labeling Wireless Sensor Network" pdf

Ngày tải lên : 21/06/2014, 11:20

... that the capacitance (stated in terms of the amount of charge (Q) stored at a given voltage drop (across the capacitor)) of a capacitor is given by (1) (Note that: the SI unit of capacitance is ... the application on the DUT This way, the application does not need to implement an API, so any existing application can be evaluated We have evaluated a retail application but it is possible and ... connector for each solar cell (v) human body: a combination of mechanical and thermal energy naturally generated from bioorganisms or through actions such as walking and sitting The display used...

12
523
1

báo cáo khoa học: " Evaluating the effectiveness of a tailored multifaceted performance feedback intervention to improve the quality of care: protocol for a cluster randomized trial in intensive care" pps

Ngày tải lên : 10/08/2014, 11:20

... QI This team must consist of at least one intensivist and one nurse; a management representative and a data manager are suggested as additional members To target the lack of motivation to change, ... cluster randomized trial to evaluate the effect of the InFoQI program on the quality of ICU care and a qualitative process evaluation to gain insight into the barriers and success factors that affected ... patient records available in, e.g., their patient data management system Each month, participants upload their data from the local, electronic database to the central, electronic registry database...

10
421
0

Báo cáo y học: " Severe hydrops in the infant of a Rhesus D-positive mother due to anti-c antibodies diagnosed antenatally: a case report" pot

Ngày tải lên : 11/08/2014, 11:23

... However, the combination of anti-c and anti-E antigens can cause the occurrence of severe fetal and neonatal haemolytic disease [3] The management of anti-c isoimmunisation or isoimmunisation with any ... out the literature search and wrote the manuscript SK, KR, JBS and GK helped in managing the case and in providing the final draft of the manuscript All authors read and approved the final manuscript ... hepatosplenomegaly, pallor and hypotonia At birth, 150 ml of ascitic tap was done and the baby was transferred to the nursery on bag and tube ventilation Her cord blood hematocrit was 15 and total serum...

4
408
0

báo cáo khoa học:" Endoscopically assisted procedure for removal of a foreign body from the maxillary sinus and contemporary endodontic surgical treatment of the tooth" ppt

Ngày tải lên : 11/08/2014, 23:22

... the action of the cilia that continue to clear mucus toward the natural ostium It is possible that the foreign body dislocated near the maxillary natural ostium created an antral inflammation of ... foreign body from the maxillary sinus J Can Dent Assoc 2005, 71(3):200-1 Ishikawa M, Mizuno T, Yamazaki Y, Satoh T, Notani K, Fukuda H: Migration of gutta-percha point from a root canal into the ethmoid ... of the overlying mucosa and a disturbance in the clearence of the maxillary sinus This fact with the concomitant hypertrophy of the inferior turbinates may explain the patient's previous symptoms...

5
420
0

Báo cáo khoa học: " Molecular characterization and phylogenetic analysis of the complete genome of a porcine sapovirus from Chinese swine" pdf

Ngày tải lên : 12/08/2014, 04:21

... GTCCACATCAACGGCCGCCGGCTCG AGCCAACAGACACTCCTGTGTTCC CATGCCAGACCCTGATATTATCACC ACCTACACCAATGTCACCTGGAC GTGCCACACCTACTATGACCACAG TCAAGCCTCCAAACCAAGCC TGGCGGTCCATAAATGAGGTG TATGCAGCTTTGGCAATTCCC TTGATCTTTAGCAACTGTATCTG ... TGGTGGAGGCCTGTTCAGAGC CCAAGTTGTGGGCTGTCAACAC CAGAGTCCTCCTGGTGGACATTC ATTACCAAGCGCAACGCTAGGC CATGTGGCCAACATGTGTG TGATTTGGTCAAGGTAGCC CCTTCTACAACACCAAATGATTGCC AGGCCAGGATGTCAACACTGGCAC ATGTATGGATAGCCCTCAGATTG ... GTGATCGGTGATGGCTAATTGCCG TGGAGATGGTATCTGTCAGTGTG GGCAGTACATTTGTGAGGGGTG CCTGTTCTGCTTTATCACCTCC GACGGTGGCTGCCATTAAAGCTG GCAGTGTAGCCGCGTACTGAGC ATTGACGTGACAGCCCCCAC TGTGGTTCTTGACTGGTGAG TGGTGGAGGCCTGTTCAGAGC...

10
401
0

Báo cáo sinh học: " Introgression of a major QTL from an inferior into a superior population using genomic selection" pdf

Ngày tải lên : 14/08/2014, 13:21

... manuscript THEM participated in software programming and helped to draft the manuscript All authors participated in the design of the study and read and approved the final manuscript Acknowledgements ... and top 10% of females The other population (donor line) was randomly selected with replacement (random 10% of the males and females) The purpose of the separation period was to generate two partially ... method of simulation and (GBLUP) analysis is rather realistic and conservative with respect to the prospects for introgression schemes in livestock and farmed fish populations http://www.gsejournal.org/content/41/1/38...

10
362
0