allotyping formed a bridge between group specific antigens and cellular proteins to the dna technological advances we are experiencing today

Báo cáo toán học: "EMILION, a tree functional-structural model: Presentation and first application to the analysis of branch carbon balance" pdf

Báo cáo toán học: "EMILION, a tree functional-structural model: Presentation and first application to the analysis of branch carbon balance" pdf

Ngày tải lên : 08/08/2014, 14:22
... assumed that SAsun has the same photosynthetic rate as a needle area illuminated by a radiation intensity of Edir/SAsun + Idif , and that SAshade has a photosynthetic rate equal to that of a surface ... SAsun (m2) is equal to the total surface of the needle segments that have a face illuminated directly by the sun SAshade is equal to the difference between total shoot area (SA) and SAsun We assumed ... than in its presence, whereas assimilation only increased by 20% The dominant climatic control on stomata appeared to be predawn water potential In any case, the stomatal limitation appeared to...
  • 15
  • 256
  • 0
Báo cáo hóa học: "The Catchment Feature Model: A Device for Multimodal Fusion and a Bridge between Signal and Sense" potx

Báo cáo hóa học: "The Catchment Feature Model: A Device for Multimodal Fusion and a Bridge between Signal and Sense" potx

Ngày tải lên : 23/06/2014, 01:20
... theater .” The SCPV peak flags a large withdrawal of the hand backward terminating in a downward beat at the word “wombats.” At this point, the nondominant hand enters the scene and both hands join ... original manual coding The subject actually introduced the ideas of “wombats” and the town “theater” for the first time with the utterance: and see the thing is || is there are wombats in the theater ... USA, 1987 M Halliday, Intonation and Grammar in British English, Mouton Press, The Hague, Paris, France, 1967 E Hajicov´ and P Sgall, “Topic and focus of a sentence and a the patterning of a...
  • 18
  • 326
  • 0
A bridge between myriad lands the ryukyu kingdom and ming china (1372 1526)

A bridge between myriad lands the ryukyu kingdom and ming china (1372 1526)

Ngày tải lên : 15/09/2015, 22:51
... 25 See Hamashita, China, East Asia and the Global Economy, pp 57-84; and Leonard Blusse, Visible Cities: Canton, Nagasaki, and Batavia and the Coming of the Americans (Cambridge: Harvard University ... presenting the latter as backward and stagnant, a similar charge made on the Fairbankian School for its depiction of China Mainland Japanese scholars, on the other hand, understand the kingdom as part ... China and a rapacious Japan On the other hand, Japan has conventionally been regarded as a monocultural society Industrial growth during the Meiji Restoration and rapid postwar recovery and economic...
  • 107
  • 694
  • 0
A Poisson bridge between fractional Brownian motion and stable Levy motion

A Poisson bridge between fractional Brownian motion and stable Levy motion

Ngày tải lên : 14/11/2015, 08:03
... respect to a compensated Poisson random measure We start by recalling some facts about Poisson random measures 2.1 Poisson random measures and integrals A recent comprehensive account on Poisson random ... Brownian motion, stable L´evy motion and the process Yα (t) Integral representations can serve as a unified framework to investigate all three processes and to understand the relation between them ... representation (10) to study local and global structure of the process Yα (t) We show that it can be regarded as a bridge between fractional Brownian motion and stable L´evy motion and exhibits an intrinsic...
  • 17
  • 406
  • 0
Aging and decision making: a comparison between neurologically healthy elderly and young individuals ppt

Aging and decision making: a comparison between neurologically healthy elderly and young individuals ppt

Ngày tải lên : 22/03/2014, 14:20
... buyers The sellers are given an item and told that they are its owners They are then asked to indicate the minimum they would accept to sell the item, the WTA Buyers are shown the same item and are ... was the actual round A pen and a picture frame were used in the hypothetical situations, and a coffee mug was used for the actual situation Only the actual round had a real payoff, either the mug ... the random offer, they gave up their item and received the amount of the random offer If the WTA was greater, they kept the item For buyers, if the WTP was greater than or equal to the random...
  • 16
  • 597
  • 0
báo cáo hóa học:" Is there a relationship between factor V Leiden and type 2 diabetes?" doc

báo cáo hóa học:" Is there a relationship between factor V Leiden and type 2 diabetes?" doc

Ngày tải lên : 18/06/2014, 15:20
... hand, the association between diabetes and atherothrombosis is well known [9] while the association between diabetes and VTE has not been recognised by data available in the Literature [7] However, ... association between diabetes and VTE [6], but recently several Authors showed that atherosclerosis and traditional atherosclerotic risk factor as diabetes should be considered also as risk factor ... expressed as mean ± standard deviation (SD) or as number and percentage where appropriated Statistical analysis was performed with STATA http:// www.stata.com with Student t test for unpaired data or...
  • 4
  • 594
  • 0
Intestinal Fish Parasites as Heavy Metal Bioindicators: A Comparison Between Acanthocephalus lucii (Palaeacanthocephala) and the Zebra Mussel, Dreissena polymorpha pot

Intestinal Fish Parasites as Heavy Metal Bioindicators: A Comparison Between Acanthocephalus lucii (Palaeacanthocephala) and the Zebra Mussel, Dreissena polymorpha pot

Ngày tải lên : 28/07/2014, 17:21
... thus also recorded between the size and weight of perch and the cadmium 18 content of the parasites An association between the infrapopulation biomass of A lucii and the cadmium burden of the ... (Table 2) Taking into consideration correlations between the age and weight of acanthocephalans (see e.g Kennedy and Moriarty 1987) the above association may reflect a longer exposure time and ... from the substratum One sampling site was close to the Salzburg to Vienna motorway and received road runoff via a small stream entering the lake The reference site was about 10 km away from the...
  • 8
  • 398
  • 0
Báo cáo khoa hoc:" Adaptive significance of amylase polymorphism in Drosophila. Analysis of the association between tissue-specific expression and specific activity in Amy or Amy genotypes F S of Drosophila subobscura" ppt

Báo cáo khoa hoc:" Adaptive significance of amylase polymorphism in Drosophila. Analysis of the association between tissue-specific expression and specific activity in Amy or Amy genotypes F S of Drosophila subobscura" ppt

Ngày tải lên : 09/08/2014, 18:21
... regions and the specific activity of the enzyme, as parameters, were analysed within and between the Amy and Amy genotypes Line grouping s F was performed according to deviations outside ± standard ... Student’s) and non-parametric tests (Mann-Whitney, Kruskal-Wallis analysis of variance and correlation) were used for the analysis of the results In this way, the variability in the number of active ... specific activity of a- amylase was carried out according to the method described by Noelting and Bernfeld [11] Midgut dissection and aamylase activity pattern were performed according to Abraham...
  • 9
  • 277
  • 0
Báo cáo y học: " Analysis of the replication of HIV-1 forced to use tRNAMet(i) supports a link between primer selection, translation and encapsidation" ppsx

Báo cáo y học: " Analysis of the replication of HIV-1 forced to use tRNAMet(i) supports a link between primer selection, translation and encapsidation" ppsx

Ngày tải lên : 13/08/2014, 09:20
... ggaaaatctctagcagtggtagcagaggatggttctgaaagcgaaagggaaac 3' Met(i) 5' gtttccctttcgctttcagaaccatcctctgctaccactgctagagattttcc 3' 5' ggaaaatctctagcagtggtagcagagggtggttctgaaagcgaaagggaaac 3' Met(i) AG ... 5'aattTAATACGACTCACTATAGGcccggatagctcagtcgg 3' and 5'cgcccgaacagggacttgaaccctgg accctcagattaaaagtctgatgctctaccgactgagctatccgggc 3' (tRNALys,3); 5' aattTAATACGACTCACTATAGGcctcgttagcgcagtagg 3' and ... tgccccgtgtgaggatcgaactcacg accttcagattatgagactgacgcgctacctactgcgctaacgagg (tRNAMet(e)); 5' aattTAATACGACTCACTATAGGagcagagtggcgcagcgg 3' and 5' tagcagaggatggtttcgatccatcg acctctgggttatgggcccagcacgcttccgctgcgccactctgct...
  • 14
  • 189
  • 0
minority shareholders protection in shareholding companies a comparison between vietnamese enterprises law and the united kingdom company law

minority shareholders protection in shareholding companies a comparison between vietnamese enterprises law and the united kingdom company law

Ngày tải lên : 18/08/2014, 12:34
... obtain the approval from the shareholders Directors are required to manage companies more transparently and make publicly available relevant information about important transactions Either a loan ... of the Board of Management have a general power to call all general meetings97 In a situation in which the management harms the company or the shareholders at any time between the regular/annual ... of it were to discriminate between the majority shareholders and the minority shareholders, so as to give to the former an advantage of which the latter were deprived When the cases are examined...
  • 60
  • 404
  • 1
Does a Causal Link Exist between Foreign Direct Investment and Economic Growth in the Asian NIEs

Does a Causal Link Exist between Foreign Direct Investment and Economic Growth in the Asian NIEs

Ngày tải lên : 14/05/2015, 14:22
... Singapore, Indonesia, Malaysia, Thailand, and the Philippines, this paper tests the causal relationship between the two variables of GDP growth and FDI inflow Data for Thailand, Indonesia, Malaysia, ... production Regarding causality of FDI and economic growth, it is an ongoing debated issue Hansen and Rand (2004) analyze the causal links between FDI and GDP and the causality of these two variables ... significant causal link However, for Singapore, Malaysia, Thailand, and the Philippines, Granger causality tests not show a statistically significant causal relationship between FDI and GDP in any...
  • 37
  • 358
  • 0
Tài liệu A REVIEW OF INDOOR AIR POLLUTION AND HEALTH PROBLEMS FROM THE VIEWPOINT OF ENVIRONMENTAL HYGIENE: FOCUSING ON THE STUDIES OF INDOOR AIR ENVIRONMENT IN JAPAN COMPARED TO THOSE OF FOREIGN COUNTRIES pptx

Tài liệu A REVIEW OF INDOOR AIR POLLUTION AND HEALTH PROBLEMS FROM THE VIEWPOINT OF ENVIRONMENTAL HYGIENE: FOCUSING ON THE STUDIES OF INDOOR AIR ENVIRONMENT IN JAPAN COMPARED TO THOSE OF FOREIGN COUNTRIES pptx

Ngày tải lên : 17/02/2014, 22:20
... Kanazawa, A. , Tanaka, M., Yoshimura, T., Chikara, H., Takigawa, T., Morimoto, K., Nakayama, K and Shibata, E (2009) Regional differences in residential environmenets and the association of dwellings ... Japanese dwellings.65) Dermatophagoides pteronyssiums, and Dermatophagoides farinae are important allergens causing allergies in Japan.66) Chemical Factors VOCs are organic compounds that have ... SO2 are associated with the use of coal and other fuels for heating and cooking.52) Biological Pollutants Dander, mold, dust, and other organisms carried into by animals and people are biological...
  • 14
  • 940
  • 1
Tài liệu Báo cáo khoa học: a-Defensins increase lung fibroblast proliferation and collagen synthesis via the b-catenin signaling pathway doc

Tài liệu Báo cáo khoa học: a-Defensins increase lung fibroblast proliferation and collagen synthesis via the b-catenin signaling pathway doc

Ngày tải lên : 18/02/2014, 06:20
... The target sequences for the mRNA of b-catenin were 5¢-AAAGCTGATATTGATGGACAG-3¢ The siRNA against luciferase mRNA was used as a control siRNA The target sequence for luciferase mRNA was 5¢-AACG ... TACGCGGAATACTTCGA-3¢ The siRNAs were customsynthesized by Qiagen (Valencia, CA, USA) and were transfected into lung fibroblasts using Qiagen RNAiFest transfection reagent in accordance with the ... Thr390-phosphorylated and Ser9-phosphorylated GSK3b without an alteration in the protein contents of total p38 MAP kinase, total Akt, and total GSK3b, suggesting that a- defensin-1 and a- defensin-2 cause the activation...
  • 12
  • 602
  • 0
Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc

Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc

Ngày tải lên : 05/03/2014, 17:20
... of the chamber to dissipate any heat built up in the transducer The transducer was affixed to an offset cam to allow it to rotate in a horizontal plane against the bottom of the ultrasound chamber ... and increased lumen diameter due to the loss of all spermatocytes and spermatids (D) Tubules that appear to have a larger epithelial layer and smaller diameter lumen were still missing spermatocytes ... treated animals, performed necropsies and analyzed sperm All authors participated in experimental design and read and approved the final manuscript The authors declare that no actual or potential conflict...
  • 15
  • 967
  • 0
Next Generation Connectivity: A review of broadband Internet transitions and policy from around the world pdf

Next Generation Connectivity: A review of broadband Internet transitions and policy from around the world pdf

Ngày tải lên : 06/03/2014, 21:20
... Korea Iceland Sweden Denmark Finland Japan Luxembourg Norway United Kingdom Switzerland Netherlands Australia Belgium Germany France Canada United States Spain Austria New Zealand Italy Ireland ... both fixed and mobile, are based) The Netherlands and Canada both well on the fixed-broadband penetration front, but are substantially weaker on 3G; while Italy and Spain exhibit the inverse ... Denmark, Norway, and Iceland, as well as the Netherlands, Switzerland, and South Korea The second quintile includes, in addition to Sweden and Finland: Canada, the United Kingdom, Belgium, and Luxembourg...
  • 232
  • 669
  • 0
Báo cáo khoa học: Dissociation/association properties of a dodecameric cyclomaltodextrinase Effects of pH and salt concentration on the oligomeric state pot

Báo cáo khoa học: Dissociation/association properties of a dodecameric cyclomaltodextrinase Effects of pH and salt concentration on the oligomeric state pot

Ngày tải lên : 07/03/2014, 12:20
... calculating the peak area during the dissociation process The rate of change in the peak area shown in Fig 3A was estimated according to an equation of single exponential decay [7], peak areaịt ... 5Â-AGTACATGTGGGACGTCAC CATGGAGTATGTCCC-3Â (forward) and 5Â-GGGACAT ACTC CATGGTGACGTCCCACATGTACT-3Â (reverse); for the H89V mutant, 5Â-TCTGCTGCAGCA GGGTGTT GAGAAGCGCTGGATG-3Â (forward) and 5Â-CATCCAG CGCTTCTCAACACCCT ... The thermal power obtained was averaged for 30 s prior to the subsequent injection to obtain the most accurate power measurements These rates were corrected for DHapp and the data were tted to the...
  • 13
  • 511
  • 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Ngày tải lên : 07/03/2014, 16:20
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGATAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT...
  • 12
  • 772
  • 0
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

Ngày tải lên : 07/03/2014, 21:20
... 5¢-GCC AGATCCCAAATTAGTGC-3¢; QaTGFbsfR2, 5¢-TGAA ACCACAGCCTCAGTTG-3¢, where ‘s’ and a indicate sense and antisense primers, respectively Accurate amplification of the target amplicon was checked ... (blastula, gastrula, trochophore larvae, D larvae, and 14 days post fertilization larvae, pediveliger larvae and metamorphosing larvae) were used as samples Although Cg-BMPR1 and Cg-TGFbsfR2 transcripts ... in flies (mad Drosophila mutants) and worms (sma Caenorhabditis mutants) These move to the nucleus to associate with transcriptional coactivators and regulate the transcription of target genes...
  • 17
  • 508
  • 0
A framework for Enhancing Airlift planning and Excution Capabilities Within the Joint Expeditionary Movement System docx

A framework for Enhancing Airlift planning and Excution Capabilities Within the Joint Expeditionary Movement System docx

Ngày tải lên : 15/03/2014, 16:20
... and execution -specific objectives and tasks and relate these to higher-level military and national security objectives Then, we adapt and apply the closedloop framework to theater airlift planning ... contributed to this research; we assume responsibility for any errors Abbreviations ACS AE AECT ALCT AMC AMCT AMD AME ANG AOC AOR APOD APOE ARCENT Agile Combat Support Aeromedical Evacuation Aeromedical ... to the COMAFFOR A3 /5 enhanced staff and to the TACC and USTRANSCOM DDOC • A J3 organization needs to be established and staffed to perform integrated requirements forecasts and guidance (demand-side)...
  • 151
  • 453
  • 0
Báo cáo khoa học: Three-dimensional structure of a thermostable native cellobiohydrolase, CBH IB, and molecular characterization of the cel7 gene from the filamentous fungus, Talaromyces emersonii ppt

Báo cáo khoa học: Three-dimensional structure of a thermostable native cellobiohydrolase, CBH IB, and molecular characterization of the cel7 gene from the filamentous fungus, Talaromyces emersonii ppt

Ngày tải lên : 23/03/2014, 13:20
... transcription, 24 h and 48 h (lanes 16 and 17) of cel7 after transfer to lactose The bottom panel is the 18S ribosomal RNA loading control ˚ for the main chain were 20.91 A2 and root-mean-square deviations ... (GenBank: AAA19802), T reesei (GenBank CAA49596), A niger (GenBank AAF04491), H grisea (GenBank AAD11942) and A aculeatus (GenBank BAA25183) gave sequence identity values of 65%, 64%, 73%, 51% and ... GenBank AAA19802), and Trichoderma reesei (T.reesei; GenBank CAA49596) Residues in white against a black background are amino acids that are identical or have a conserved substitution in all...
  • 12
  • 553
  • 0

Xem thêm